View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6909_low_31 (Length: 246)
Name: NF6909_low_31
Description: NF6909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6909_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 234
Target Start/End: Complemental strand, 20108781 - 20108556
Alignment:
| Q |
9 |
tcgagtttcgtgttggagttcatgtccaaaatagatacaccaaagtttaaattgagattgcagttgtagggaggttgcagtcacagcgattgctgagatg |
108 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
20108781 |
tcgagattcgtgttagagttcatgtccaaaatagatacaccaaagtttaaattgggattgcagttgtaggaaggttgcagtcacagcggttgctgagatg |
20108682 |
T |
|
| Q |
109 |
tttattgcgaccgctgttacaatagcctttattgagttttagattctggaatgtatcttttgtagcataggtacatgcttatatttttctcaactaaccc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20108681 |
tttattgcgaccgctgttacaatagcctttattgagttttagattctggaatgtgtcttttgcagcataggtacatgcttatatttttctcaactaaccc |
20108582 |
T |
|
| Q |
209 |
tagttatttaactcttctttgatgtc |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
20108581 |
tagttatttaactcttctttgatgtc |
20108556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University