View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6910_high_10 (Length: 241)
Name: NF6910_high_10
Description: NF6910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6910_high_10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 32650776 - 32650552
Alignment:
| Q |
14 |
tcagcatctcaattcgtttactctttcctttcatttatttgcattatcgccgtgataaatggatcagaattgttctgatatttacacaaatataaacaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32650776 |
tcagcatctcaattcgtttactctttcctttcatttattttcattatggccgtgatgaatggatcagaattgttctgatatttacacaaatataaacaaa |
32650677 |
T |
|
| Q |
114 |
cccctcatgaaatgatttcagtacgttaatcattatgattgttcacgttctggtactttttcctttggattccacctctctctaatattaattttcttgt |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32650676 |
cccctcatgaaatgatttca----gttaatcattatgattgttcacgttctggtactttttcctttggattccacctctctctaatattaattttcatgt |
32650581 |
T |
|
| Q |
214 |
-gtccaattttgttttgggtttcattgct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32650580 |
ggtccaattttgttttgggtttcattgct |
32650552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University