View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6910_low_16 (Length: 229)
Name: NF6910_low_16
Description: NF6910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6910_low_16 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 1727593 - 1727370
Alignment:
| Q |
7 |
caaccatgtcacaatgctcatagttcaagtatacaaaataagtctacatgtacatgtatctagtgagagaagtcttttctgctgtaataaataatgcaa- |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1727593 |
caaccatgtcacaatgctcatagttcaagtatacaaaataagtctacatgtacatgtatctagtgagagaagtcttttctgctgtaataaataatgcaat |
1727494 |
T |
 |
| Q |
106 |
aaacccaccttgttgtnnnnnnntaatgtataatgagatcacgtagcagttatatcaatggcaaatttttcagactagcccaaatcaccacgttattctc |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1727493 |
aaacccaccttgttgtaaaaaaataatgtataatgagatcacgtagcagttatatcaatgacaaatttttcagactagcccaaatcaccacgttattctc |
1727394 |
T |
 |
| Q |
206 |
gtgaccgcaagaattattttcttt |
229 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
1727393 |
gtgaccgcaagaatgattttcttt |
1727370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University