View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6910_low_17 (Length: 220)
Name: NF6910_low_17
Description: NF6910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6910_low_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 3 - 220
Target Start/End: Original strand, 32650065 - 32650280
Alignment:
| Q |
3 |
aaaccaaaatgcaggaaaataacttgtaagcttttgaaagcttctatccatatacactgcaatttggaacatgtggatcgtccctatttcatttggaacc |
102 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32650065 |
aaaccaaaatgcaggaaaataacatgtaagcttttgaaagcttctatccatatagactgcaatttggaacatgtagatcgtccctatttcatttggaacc |
32650164 |
T |
|
| Q |
103 |
tgctattactttaaaagttaatggggagtgtgtttttgtcatagattttgcatttctatgtgctgaactgcatatatgaccnnnnnnnnaaggttgtctt |
202 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
32650165 |
tgctattacttt-aaagttaatggggagtgtgtttttgtcatatattttgcatttctatgtgttgaactgcatatatgacc-tttttttaaggttgtctt |
32650262 |
T |
|
| Q |
203 |
atgagttgcagacaattt |
220 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32650263 |
atgagttgcagacaattt |
32650280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 11 - 48
Target Start/End: Original strand, 2388386 - 2388423
Alignment:
| Q |
11 |
atgcaggaaaataacttgtaagcttttgaaagcttcta |
48 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2388386 |
atgcaggaaaataacttgtaagctttccaaagcttcta |
2388423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University