View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6910_low_7 (Length: 362)
Name: NF6910_low_7
Description: NF6910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6910_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 210 - 345
Target Start/End: Complemental strand, 814199 - 814063
Alignment:
| Q |
210 |
cgagtcctcgaggatatggaggttagttcaaagaattcgtggattgcttgtgatggagtgaaaagtaacattcttattatgagacaaaccattgtga-ga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
814199 |
cgagtcctcgaggatatggaggttagttcaaagaattcgtcgattgcttgtgatggagtgaaaagtaacattcttattatgtgacaaaccattgtgagga |
814100 |
T |
|
| Q |
309 |
tactttgatagataatggttgtaatttatctcttggt |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
814099 |
tactttgatagataatggttgtaatttatctcttggt |
814063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 814404 - 814321
Alignment:
| Q |
1 |
atatccttgtccttcaatataaaagatacacactaagcaaaaaatgtcatgtcatcatgtcgtaactattattataacaacttcag |
86 |
Q |
| |
|
|||||| ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
814404 |
atatccctgtccttcaatataaaatatacac--taagcaaaaaatgtcatgtcatcatgtcgtaactattattataacaacttcag |
814321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University