View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6911_high_16 (Length: 240)
Name: NF6911_high_16
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6911_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 20703399 - 20703490
Alignment:
| Q |
19 |
tagtaccttggagggttcattctcctaaagagtttctcatattcatcatccatgtaatgagactgagaatagctcatgttgacttcagaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20703399 |
tagtaccttggagggttcattctcctaaagagtttctcatattcatcatccatgtaatgagactgagaatagctcatgttgacttcagaaat |
20703490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University