View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6911_high_20 (Length: 210)
Name: NF6911_high_20
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6911_high_20 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 28334018 - 28334227
Alignment:
| Q |
1 |
cggactcattggagatggaattaccttcttcattgcaccattcaattctcacatccccaaaaattcgagtggtggattccttggactattcaacgcggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28334018 |
cggactcattggagatggaattaccttcttcattgcaccattcaattctcacatcccgaaaaattcgagtggtggattccttggactattcaacgcggaa |
28334117 |
T |
 |
| Q |
101 |
actgctttgaatacgtaccaaaatcgaattgttgccgttgaatttgattcctttggtggagatagtggtggaaatccttgggatcccgcgtatccccatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28334118 |
actgctttgaatacgtaccaaaatcgaattgttgccgttgaatttgattcctttggtggaaatagtggtggaaatccttgggatcccgcgtatccccatg |
28334217 |
T |
 |
| Q |
201 |
ttggcattga |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
28334218 |
ttggcattga |
28334227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 28337239 - 28337436
Alignment:
| Q |
1 |
cggactcattggagatggaattaccttcttcattgcaccattcaattctcacatccccaaaaattcgagtggtggattccttggactattcaacgcggaa |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28337239 |
cggactctttggagatggaattaccttcttcattgcaccattcaactctcacatcccgaaaaattcgagtggtggattccttggactattcaacgcggaa |
28337338 |
T |
 |
| Q |
101 |
actgctttgaatacgtaccaaaatcgaattgttgccgttgaatttgattcctttggtggagatagtggtggaaatccttgggatcccgcgtatccccatg |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||| |
|
|
| T |
28337339 |
actgctttgaatacataccaaaatcgaatcgttgccgttgaatttgattcctt------------tggtggaaatccttgggatccagtgtatccccatg |
28337426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University