View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6911_high_7 (Length: 372)

Name: NF6911_high_7
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6911_high_7
NF6911_high_7
[»] chr3 (13 HSPs)
chr3 (7-174)||(26846192-26846359)
chr3 (251-372)||(26845994-26846115)
chr3 (7-162)||(47537605-47537760)
chr3 (23-160)||(48192138-48192275)
chr3 (251-369)||(47537398-47537516)
chr3 (7-159)||(50544564-50544716)
chr3 (7-146)||(23818924-23819063)
chr3 (7-118)||(43121314-43121425)
chr3 (258-369)||(50544354-50544465)
chr3 (251-366)||(48191932-48192047)
chr3 (279-366)||(33121237-33121324)
chr3 (293-337)||(19222260-19222304)
chr3 (251-315)||(43121558-43121622)
[»] chr1 (12 HSPs)
chr1 (7-174)||(26720958-26721125)
chr1 (7-174)||(30110572-30110740)
chr1 (251-372)||(26720788-26720909)
chr1 (7-174)||(10710809-10710976)
chr1 (23-174)||(47106347-47106498)
chr1 (251-369)||(47106573-47106690)
chr1 (251-353)||(10711053-10711155)
chr1 (68-174)||(17708304-17708410)
chr1 (251-366)||(17708112-17708227)
chr1 (251-364)||(30110817-30110930)
chr1 (39-159)||(28097645-28097765)
chr1 (258-369)||(21335269-21335379)
[»] scaffold0179 (4 HSPs)
scaffold0179 (7-174)||(7853-8024)
scaffold0179 (7-174)||(12787-12958)
scaffold0179 (251-372)||(7655-7776)
scaffold0179 (251-372)||(12589-12710)
[»] chr5 (8 HSPs)
chr5 (7-174)||(20208367-20208534)
chr5 (251-372)||(20208611-20208732)
chr5 (8-160)||(7000414-7000566)
chr5 (251-364)||(6049358-6049471)
chr5 (23-172)||(6049548-6049697)
chr5 (251-372)||(7000657-7000778)
chr5 (68-174)||(4415409-4415515)
chr5 (251-366)||(4415592-4415707)
[»] chr6 (14 HSPs)
chr6 (5-174)||(18051095-18051264)
chr6 (7-174)||(17078839-17079006)
chr6 (23-162)||(649730-649869)
chr6 (23-174)||(17873483-17873634)
chr6 (251-369)||(17873710-17873828)
chr6 (7-162)||(11060510-11060665)
chr6 (23-161)||(9198916-9199054)
chr6 (251-353)||(11060751-11060853)
chr6 (251-364)||(18051341-18051454)
chr6 (252-364)||(17079084-17079196)
chr6 (251-354)||(9199144-9199247)
chr6 (47-90)||(19350353-19350396)
chr6 (251-293)||(649958-650000)
chr6 (289-342)||(4474855-4474908)
[»] chr4 (16 HSPs)
chr4 (23-174)||(53780370-53780521)
chr4 (23-174)||(34321983-34322134)
chr4 (5-174)||(20395907-20396076)
chr4 (30-174)||(10563002-10563146)
chr4 (251-369)||(10563201-10563319)
chr4 (251-364)||(20395731-20395844)
chr4 (253-369)||(53780175-53780291)
chr4 (26-161)||(42778576-42778711)
chr4 (251-354)||(42778383-42778486)
chr4 (251-366)||(53486845-53486960)
chr4 (251-366)||(30273704-30273819)
chr4 (251-366)||(34322211-34322326)
chr4 (23-102)||(53486600-53486679)
chr4 (251-355)||(18106448-18106552)
chr4 (105-161)||(53486699-53486755)
chr4 (25-79)||(29553406-29553460)
[»] scaffold0007 (2 HSPs)
scaffold0007 (5-174)||(182440-182609)
scaffold0007 (251-364)||(182264-182377)
[»] chr8 (7 HSPs)
chr8 (7-162)||(17659168-17659323)
chr8 (251-369)||(23680292-23680410)
chr8 (25-174)||(45255495-45255644)
chr8 (253-369)||(45255722-45255838)
chr8 (251-364)||(17658966-17659079)
chr8 (7-146)||(36157508-36157647)
chr8 (69-147)||(23680514-23680592)
[»] scaffold0912 (1 HSPs)
scaffold0912 (5-174)||(2519-2688)
[»] chr7 (6 HSPs)
chr7 (7-159)||(4077615-4077767)
chr7 (23-174)||(34232024-34232175)
chr7 (251-369)||(7458563-7458681)
chr7 (251-369)||(4077405-4077523)
chr7 (251-366)||(34231832-34231947)
chr7 (25-79)||(27941160-27941214)
[»] chr2 (5 HSPs)
chr2 (26-146)||(1380435-1380555)
chr2 (251-355)||(2999640-2999744)
chr2 (251-354)||(1380227-1380330)
chr2 (7-146)||(11028223-11028362)
chr2 (25-107)||(25381050-25381132)


Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 7 - 174
Target Start/End: Complemental strand, 26846359 - 26846192
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
26846359 tggtggtggctgatttggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgataagtggttagggtcggtttctttgtgt 26846260  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
26846259 gagcggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggattgttctctct 26846192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 251 - 372
Target Start/End: Complemental strand, 26846115 - 26845994
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26846115 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 26846016  T
351 atcacttgttgacttcaaatga 372  Q
    ||||||||||||||||||||||    
26846015 atcacttgttgacttcaaatga 26845994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 47537760 - 47537605
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||| ||||||||||| |||    
47537760 tggtggaggctggtttggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtatgataggtggttaggatcggtttctttttgt 47537661  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcagg 162  Q
    ||| ||||| |||||||||| |||||| ||||||||||||| ||||| ||||||||    
47537660 gagcggtttactaggttgttcgatctttctgagaacaaatccattacagtggcagg 47537605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 23 - 160
Target Start/End: Complemental strand, 48192275 - 48192138
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggt 122  Q
    ||||||||||||||||||||||||||||||||||  |||||||||||||||| ||| ||||||||||| |||| ||||||||||| | ||||| ||||||    
48192275 ggggagtgtgtgtctaagaagttgggggatggttttgacactttgttttggtatgataagtggttaggatcggcttctttgtgtgggcggttttctaggt 48192176  T
123 tgtttgatcttgctgagaacaaatctattacggtggca 160  Q
    |||| ||| || ||||||||||||| ||||||||||||    
48192175 tgttcgatttttctgagaacaaatccattacggtggca 48192138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 251 - 369
Target Start/End: Complemental strand, 47537516 - 47537398
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||| ||||| || || ||||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |    
47537516 tgtagggctttattgactgatgtttttctgctagattttgttttagacaggtgggtgtggttgccagaccctgttgagggttacactgttcgtggttcat 47537417  T
351 atcacttgttgacttcaaa 369  Q
    |||||||| ||||| ||||    
47537416 atcacttgctgactacaaa 47537398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 7 - 159
Target Start/End: Complemental strand, 50544716 - 50544564
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || |||||||||||||| || |||||||  |||||||| ||||| |||||||||| ||| ||||||||||| ||||||||||| |||    
50544716 tggtggaggctggtttggggagtgtgtgtcgaaaaagttggttgatggttctgacaccttgttttggtatgataagtggttaggatcggtttctttttgt 50544617  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggc 159  Q
    ||  || ||||| | ||||||||||||  |||||||||||| |||||||||||    
50544616 gaccggattcctcgattgtttgatctttatgagaacaaatccattacggtggc 50544564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 7 - 146
Target Start/End: Complemental strand, 23819063 - 23818924
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||  ||| | |||    
23819063 tggtggaggctggtttggggagtgtgtgtcaaagaagttgggggatggttccgatactttgttttggtttgataagtggttagggtcggcatctctatgt 23818964  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaat 146  Q
    | | |||||||| |  | |||||||||  |||||||||||    
23818963 gtgaggtttcctcgcctatttgatctttatgagaacaaat 23818924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 7 - 118
Target Start/End: Original strand, 43121314 - 43121425
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||  ||| |||||    
43121314 tggtggaggctggtttggggagtgtgtgtcaaagaagttgggggatggttccgatactttgttttggtttgataagtggttagggtcggcatctctgtgt 43121413  T
107 gagtggtttcct 118  Q
    | | ||||||||    
43121414 gtgaggtttcct 43121425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 258 - 369
Target Start/End: Complemental strand, 50544465 - 50544354
Alignment:
258 ctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttcttatcactt 357  Q
    |||||||||||||||||||||||||||  | |||||||||||| ||||||||| |||| ||||||| |||||||||| | ||||||||||||||||  ||    
50544465 ctttattgactgatgtttctctgcaagaatttgtttcagacagatgggtgtggctgccagaccctggtgagggttactcagttcgcggttcttatctatt 50544366  T
358 gttgacttcaaa 369  Q
    ||||||| ||||    
50544365 gttgactacaaa 50544354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 251 - 366
Target Start/End: Complemental strand, 48192047 - 48191932
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| |||||||||||||||||| |||||| || |||||| ||||||||||||||||| || |||||| | | ||||||| ||||||| ||||| |    
48192047 tgtagggccttattgactgatgtttctttgcaagattttgtttccgacaggtgggtgtggtttccagaccctttggtgggttactctgttcgtggttcat 48191948  T
351 atcacttgttgacttc 366  Q
    ||||| || |||||||    
48191947 atcacatgctgacttc 48191932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 279 - 366
Target Start/End: Original strand, 33121237 - 33121324
Alignment:
279 tgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttcttatcacttgttgacttc 366  Q
    |||||| || |||||| |||||||||||||||||||| |||||| | | ||||||| ||||||| ||||| |||||| || |||||||    
33121237 tgcaagattttgtttccgacaggtgggtgtggttgccagaccctttggtgggttactctgttcgtggttcatatcacatgctgacttc 33121324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 293 - 337
Target Start/End: Original strand, 19222260 - 19222304
Alignment:
293 tcagacaggtgggtgtggttgcctgaccctgttgagggttacact 337  Q
    ||||||||||||||||||||||| |||||||||||||||| ||||    
19222260 tcagacaggtgggtgtggttgccagaccctgttgagggttgcact 19222304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 251 - 315
Target Start/End: Original strand, 43121558 - 43121622
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcc 315  Q
    |||||| ||||||||  ||||||||||||||| | |  ||||||||||| |||||| ||||||||    
43121558 tgtaggactttattgcttgatgtttctctgcatgctaatgtttcagacaagtgggtttggttgcc 43121622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 148; Significance: 5e-78; HSPs: 12)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 7 - 174
Target Start/End: Complemental strand, 26721125 - 26720958
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
26721125 tggtggtggctggtttggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgataagtggttagggtcggtttctttgtgt 26721026  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
26721025 gagcggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggattgttctctct 26720958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 30110572 - 30110740
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggtt-agggtcggtttctttgtg 105  Q
    |||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||| ||||||||||| ||    
30110572 tggtggaggctggtttggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtatgataagtggtttaggatcggtttctttttg 30110671  T
106 tgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||    
30110672 tgagaggtttcctaggttgtttgatctttctgagaacaaatctattacggtggcaggtttgttctctct 30110740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 251 - 372
Target Start/End: Complemental strand, 26720909 - 26720788
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||    
26720909 tgtagggctttattgactgatgtttctctgcaagtttttgtttcagacaggtgggtgtggtcgtcagaccctgttgagggttacactgttcgcggttctt 26720810  T
351 atcacttgttgacttcaaatga 372  Q
    ||||||||||||||||||||||    
26720809 atcacttgttgacttcaaatga 26720788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 10710809 - 10710976
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || | ||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||| ||||| ||||| |||    
10710809 tggtggaggctggtttgcggagtgtgtgtctaagaagttggggaatggttcagacactttgttttggtatgataagtggttaggatcggtctctttttgt 10710908  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||| | ||||||||||||||||||||| ||||||||||||| |||||||||||||| || ||||||||    
10710909 gagcgatttcctaggttgtttgatctttctgagaacaaatccattacggtggcaggtttgttctctct 10710976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 23 - 174
Target Start/End: Original strand, 47106347 - 47106498
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggt 122  Q
    ||||||||||||| ||||||||||||||||||||| || ||||||||||||| ||| ||||||||||| || ||||| ||  || || ||||||||||||    
47106347 ggggagtgtgtgtttaagaagttgggggatggttccgatactttgttttggtatgataagtggttaggatcagtttcgtttcgtaagaggtttcctaggt 47106446  T
123 tgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||||||||| ||||||| ||||  |||||||||||||| || ||||||||    
47106447 tgtttgatctttctgagaataaattcattacggtggcaggtttgttctctct 47106498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 251 - 369
Target Start/End: Original strand, 47106573 - 47106690
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||| |||||| || |||||| |||||||||||||||||||| |||||||||||||| |  |||||||||||||| |    
47106573 tgtagggctttattgactgatgtttctttgcaagattttgtttccgacaggtgggtgtggttgccagaccctgttgaggggt-tactgttcgcggttcat 47106671  T
351 atcacttgttgacttcaaa 369  Q
    |||||||| ||||| ||||    
47106672 atcacttgctgactacaaa 47106690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 251 - 353
Target Start/End: Original strand, 10711053 - 10711155
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||| ||||||| |||||||||||| | |||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |    
10711053 tgtaggactttattaactgatgtttctttccaagattttgtttcagacaggtgggtgtggttgccagaccctgttgagggttacactgttcgtggttcat 10711152  T
351 atc 353  Q
    |||    
10711153 atc 10711155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 68 - 174
Target Start/End: Complemental strand, 17708410 - 17708304
Alignment:
68 ttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttt 167  Q
    ||||||| ||| ||||||||||| |||||||||||||||||| |||||||||||||||| |||||| ||||||||||||| |||||||||||||  || |    
17708410 ttttggtatgataagtggttaggatcggtttctttgtgtgagcggtttcctaggttgttcgatctttctgagaacaaatccattacggtggcagacttgt 17708311  T
168 tctctct 174  Q
    |||||||    
17708310 tctctct 17708304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 251 - 366
Target Start/End: Complemental strand, 17708227 - 17708112
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| |||||||||||||||||| |||||| || |||||||||||| ||||||||||||||  ||||| ||| ||||||| ||||||| ||||| |    
17708227 tgtagggccttattgactgatgtttctttgcaagattttgtttcagacagatgggtgtggttgccaaacccttttgtgggttactctgttcgtggttcat 17708128  T
351 atcacttgttgacttc 366  Q
    ||||| || |||||||    
17708127 atcacatgctgacttc 17708112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 251 - 364
Target Start/End: Original strand, 30110817 - 30110930
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||  ||||||||||||||||| |||| || ||||||||| |||||||||||||| || |||||| ||||||| ||||| ||||| ||||| |    
30110817 tgtagggcttctttgactgatgtttctctacaagattttgtttcagataggtgggtgtggttaccagacccttttgaggggtacacagttcggggttcat 30110916  T
351 atcacttgttgact 364  Q
    ||||| || |||||    
30110917 atcacatgctgact 30110930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 159
Target Start/End: Original strand, 28097645 - 28097765
Alignment:
39 agaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggttgtttgatcttgctga 138  Q
    ||||||||||||||||||| || ||| ||||||||||||| |||||||||||||||  | ||||||| | | ||| |||| || |||||| |||| | ||    
28097645 agaagttgggggatggttccgatactctgttttggtttgataagtggttagggtcgcctactttgtgagtgaggtatcctgggctgtttgctctttccga 28097744  T
139 gaacaaatctattacggtggc 159  Q
    ||||||||  ||||| |||||    
28097745 gaacaaattcattacagtggc 28097765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 258 - 369
Target Start/End: Original strand, 21335269 - 21335379
Alignment:
258 ctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttcttatcactt 357  Q
    ||||||||  |||||||||| |||| | |  |||||||||||||||||| |||||||  |||||| |||| || ||| | |||||||| ||||||||| |    
21335269 ctttattgcttgatgtttctttgcaggctaatgtttcagacaggtgggtatggttgcaggacccttttgaagggtactcagttcgcgg-tcttatcacct 21335367  T
358 gttgacttcaaa 369  Q
    ||||||| ||||    
21335368 gttgactacaaa 21335379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 143; Significance: 5e-75; HSPs: 4)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 7 - 174
Target Start/End: Complemental strand, 8024 - 7853
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttga----caagtggttagggtcggtttcttt 102  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||    
8024 tggtggtggctgatttggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgataattaagtggttagggtcggtttcttt 7925  T
103 gtgtgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7924 gtgtgagcggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 7853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #2
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 7 - 174
Target Start/End: Complemental strand, 12958 - 12787
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttga----caagtggttagggtcggtttcttt 102  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||    
12958 tggtggtggctgatttggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgataattaagtggttagggtcggtttcttt 12859  T
103 gtgtgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12858 gtgtgagcggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 12787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #3
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 251 - 372
Target Start/End: Complemental strand, 7776 - 7655
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7776 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 7677  T
351 atcacttgttgacttcaaatga 372  Q
    ||||||||||||||||||||||    
7676 atcacttgttgacttcaaatga 7655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #4
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 251 - 372
Target Start/End: Complemental strand, 12710 - 12589
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12710 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 12611  T
351 atcacttgttgacttcaaatga 372  Q
    ||||||||||||||||||||||    
12610 atcacttgttgacttcaaatga 12589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 8)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 20208367 - 20208534
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||||||||| || ||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||    
20208367 tggtggtggctggtttggggagtgtgtgtctaagaagtttggggatggttcaaacactttgttttggtttgataagtggttagggtcggtttctttgtgt 20208466  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
20208467 gagcggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggattgttctctct 20208534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 251 - 372
Target Start/End: Original strand, 20208611 - 20208732
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
20208611 tgtagggctttattgactgatgtttctctgcaagtttatgtttcagacaggtgggtgtggttgccagaccctgttgagggttacactgttcgcggttctt 20208710  T
351 atcacttgttgacttcaaatga 372  Q
    ||||||||||||||||||||||    
20208711 atcacttgttgacttcaaatga 20208732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 7000414 - 7000566
Alignment:
8 ggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtg 107  Q
    ||||| ||||| || |||||||||||||| ||||||||||||||||||| ||||||||| ||||||| ||| | ||||||||| | ||||||||| ||||    
7000414 ggtggaggctggtttggggagtgtgtgtccaagaagttgggggatggtttagacacttttttttggtatgataggtggttaggattggtttctttttgtg 7000513  T
108 agtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggca 160  Q
    || |||||||||||||||| |||||| ||||||  ||||| ||||| ||||||    
7000514 agcggtttcctaggttgttcgatctttctgagagtaaatccattacagtggca 7000566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 251 - 364
Target Start/End: Complemental strand, 6049471 - 6049358
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||| |||||| || | |||| |||||||||||||||||||| ||||||||| ||||||| |||||||||||||| |    
6049471 tgtagggctttattgactgatgtttctttgcaagattttttttccgacaggtgggtgtggttgccagaccctgttaagggttatactgttcgcggttcat 6049372  T
351 atcacttgttgact 364  Q
    |||||||| |||||    
6049371 atcacttgctgact 6049358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 23 - 172
Target Start/End: Complemental strand, 6049697 - 6049548
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggt 122  Q
    ||||||||||||| |||||||||  |||||||||| || ||||||||||||| ||| |||||||| || || ||||| ||  ||||| ||||||||||||    
6049697 ggggagtgtgtgtttaagaagttaagggatggttctgatactttgttttggtatgataagtggtttggatcagtttcgtttcgtgagaggtttcctaggt 6049598  T
123 tgtttgatcttgctgagaacaaatctattacggtggcaggatttttctct 172  Q
    ||||||||||| |||| || ||||| |||||||||||||| || ||||||    
6049597 tgtttgatctttctgacaataaatccattacggtggcaggtttgttctct 6049548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 251 - 372
Target Start/End: Original strand, 7000657 - 7000778
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||||||||||| |||||||||||||| || |||||||||||||| ||||||||||||||| |||||   |||||||||||||||||||||||| |    
7000657 tgtagggctttattgattgatgtttctctgctagattctgtttcagacaagtgggtgtggttgccagaccccactgagggttacactgttcgcggttcat 7000756  T
351 atcacttgttgacttcaaatga 372  Q
    ||| |||| ||||  |||||||    
7000757 atcgcttgctgaccacaaatga 7000778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 68 - 174
Target Start/End: Original strand, 4415409 - 4415515
Alignment:
68 ttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttt 167  Q
    ||||||| ||| ||||||||||| |||||||||||||||||| |||||||||||||||| ||||||| |||||||||||| |||||||||||||  || |    
4415409 ttttggtatgataagtggttaggatcggtttctttgtgtgagcggtttcctaggttgttcgatcttgttgagaacaaatccattacggtggcagacttgt 4415508  T
168 tctctct 174  Q
    |||||||    
4415509 tctctct 4415515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 251 - 366
Target Start/End: Original strand, 4415592 - 4415707
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| |||||||||||||||||| |||||| || |||||| |||||||||||||||||||| |||||| | | ||||||| ||||||| ||||| |    
4415592 tgtagggccttattgactgatgtttctttgcaagattttgtttccgacaggtgggtgtggttgccagaccctttggtgggttactctgttcgtggttcat 4415691  T
351 atcacttgttgacttc 366  Q
    || || ||||||||||    
4415692 attacatgttgacttc 4415707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 118; Significance: 4e-60; HSPs: 14)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 5 - 174
Target Start/End: Original strand, 18051095 - 18051264
Alignment:
5 tatggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgt 104  Q
    |||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||| ||||| |    
18051095 tatggtggaggctggtttggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtatgataagtggttaggatcggtctcttttt 18051194  T
105 gtgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||| || ||||||||    
18051195 gtgagcggtttcctaggttgtttgatctttctgagaacaaatccattacggtggcaggtttgttctctct 18051264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 17078839 - 17079006
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || ||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||| ||||||||||| ||||| ||||| |||    
17078839 tggtggaggctggtttggggagtgtgtgtctaagaagttgggggacggttcagacactttattttggtatgataagtggttaggatcggtctctttttgt 17078938  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||| |||||||||||||||||| |||| ||||||||||||| |||||||||||||| || ||||||||    
17078939 gagcggtttcctaggttgtttgttctttctgagaacaaatccattacggtggcaggtttgttctctct 17079006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 23 - 162
Target Start/End: Original strand, 649730 - 649869
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggt 122  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||| ||||||||||| |||||| ||||||||||||    
649730 ggggagtgtgtgtctaagaagttgggggatggtttagacactttgttttggtatgataagtggttaggatcggtttctttttgtgagcggtttcctaggt 649829  T
123 tgtttgatcttgctgagaacaaatctattacggtggcagg 162  Q
    |||| |||||| ||||||||||||| |||||| |||||||    
649830 tgttcgatctttctgagaacaaatccattacgatggcagg 649869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 23 - 174
Target Start/End: Original strand, 17873483 - 17873634
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggt 122  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||| || || ||||||||||| | ||||||||| |||||| ||||||||||||    
17873483 ggggagtgtgtgtctaagaagttgggggatggttcagacacgttgttttgattcgataagtggttaggtttggtttctttttgtgagcggtttcctaggt 17873582  T
123 tgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||||||||| ||||||||||||  |||||||||||| | || ||||||||    
17873583 tgtttgatctttctgagaacaaatacattacggtggcaagtttgttctctct 17873634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 251 - 369
Target Start/End: Original strand, 17873710 - 17873828
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| || ||| || ||||||||||||||||||||||||    
17873710 tgtagggctttattgactgatgtttctctgcaagattttgtttcagacaggtgggtgtggttgccagatcctattcagggttacactgttcgcggttctt 17873809  T
351 atcacttgttgacttcaaa 369  Q
    |||||||||||||||||||    
17873810 atcacttgttgacttcaaa 17873828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 7 - 162
Target Start/End: Original strand, 11060510 - 11060665
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || |||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||| | ||||||||| ||||||||||| |||    
11060510 tggtggaggctggtttggggagtgtgtgtctatgaagttgggggatgggtcagatactttgttttggtttgataggtggttaggttcggtttctttctgt 11060609  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcagg 162  Q
    ||| |||||||||||||||| |||||| ||||||||||||  ||||| ||||||||    
11060610 gagaggtttcctaggttgttcgatctttctgagaacaaatacattacagtggcagg 11060665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 23 - 161
Target Start/End: Original strand, 9198916 - 9199054
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggt 122  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||| ||||| |||||| ||||||||||||    
9198916 ggggagtgtgtgtctaagaagttggggaatggttcagacactttgttttggtatgataagtggttagggtcggtgtctttttgtgagcggtttcctaggt 9199015  T
123 tgtttgatcttgctgagaacaaatctattacggtggcag 161  Q
    |||| |||||| ||| ||||||||  ||| |||||||||    
9199016 tgttcgatctttctgtgaacaaattcatttcggtggcag 9199054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 251 - 353
Target Start/End: Original strand, 11060751 - 11060853
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||| ||||||||||||| ||||||||| || || |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
11060751 tgtagggatttattgactgatatttctctgctagattatgtttctgacaggtgggtgtggttgcctgacccttttgagggttacactgttcgcggttctt 11060850  T
351 atc 353  Q
    |||    
11060851 atc 11060853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 251 - 364
Target Start/End: Original strand, 18051341 - 18051454
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||||||||||||| |||||| | |||||| || | ||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||    
18051341 tgtagggctttattgactaatgtttatttgcaagattttatttcagacaggtgggtgtggttgtctgaccctgttgagggttacactgttcgtggttctt 18051440  T
351 atcacttgttgact 364  Q
    ||||| || |||||    
18051441 atcacatggtgact 18051454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 252 - 364
Target Start/End: Original strand, 17079084 - 17079196
Alignment:
252 gtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctta 351  Q
    |||||||||||||||||||||||||| |||||| || ||||||||||| ||||||||||||||| |||| |||||||||||| |||||||| ||||| ||    
17079084 gtagggctttattgactgatgtttctttgcaagattttgtttcagacaagtgggtgtggttgccagaccttgttgagggttatactgttcgtggttcata 17079183  T
352 tcacttgttgact 364  Q
    |||| || |||||    
17079184 tcacatgctgact 17079196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 251 - 354
Target Start/End: Original strand, 9199144 - 9199247
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| |||||||||||||||||| ||| || ||||||||||||||||||||| |||||||| |||| | ||| ||||||| ||||||||||||| |    
9199144 tgtagggcattattgactgatgtttctttgcgagattctgtttcagacaggtgggtttggttgccagaccatattgtgggttactctgttcgcggttcat 9199243  T
351 atca 354  Q
    ||||    
9199244 atca 9199247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 47 - 90
Target Start/End: Complemental strand, 19350396 - 19350353
Alignment:
47 ggggatggttcagacactttgttttggtttgacaagtggttagg 90  Q
    |||||||||||  ||||||||||||||||||||| |||||||||    
19350396 ggggatggttcgaacactttgttttggtttgacaggtggttagg 19350353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 251 - 293
Target Start/End: Original strand, 649958 - 650000
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgttt 293  Q
    ||||||||||||||||||||||||||| |||||| || |||||    
649958 tgtagggctttattgactgatgtttctttgcaagattttgttt 650000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 342
Target Start/End: Complemental strand, 4474908 - 4474855
Alignment:
289 tgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcg 342  Q
    |||||||||||| |||||||||||  |||||||||| | |||||| ||||||||    
4474908 tgtttcagacagatgggtgtggttatctgaccctgtggggggttatactgttcg 4474855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 104; Significance: 9e-52; HSPs: 16)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 23 - 174
Target Start/End: Complemental strand, 53780521 - 53780370
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggt 122  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||  || ||||||||||| ||||||||||| |||||| ||||||||||||    
53780521 ggggagtgtgtgtctaagaagttaggggatggttcagacactttgttttggtacgataagtggttaggttcggtttctttttgtgagcggtttcctaggt 53780422  T
123 tgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||||||||| ||||||||||||| |||||| ||||||| || ||||||||    
53780421 tgtttgatctttctgagaacaaatccattacgatggcaggtttgttctctct 53780370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 23 - 174
Target Start/End: Original strand, 34321983 - 34322134
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggt 122  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| | ||||||| | || ||||||||||||||| ||||||||||||    
34321983 ggggagtgtgtgtctaagaagttgggggatggttctgacactttgttttggtatgataggtggttatgatcagtttctttgtgtgagcggtttcctaggt 34322082  T
123 tgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    |||| |||||||||||||||||||| |||||||||||||  || ||||||||    
34322083 tgttcgatcttgctgagaacaaatccattacggtggcagacttgttctctct 34322134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 5 - 174
Target Start/End: Complemental strand, 20396076 - 20395907
Alignment:
5 tatggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgt 104  Q
    |||||||| || || || ||||||||||||||||||||||||||||||||||||||||| ||||||||||  || ||||||||||| ||||| ||||| |    
20396076 tatggtggaggttggtttggggagtgtgtgtctaagaagttgggggatggttcagacacgttgttttggtacgaaaagtggttaggatcggtctcttttt 20395977  T
105 gtgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||| ||||||||||||||||||||||| ||||||||||||| ||| |||| ||||| || ||||||||    
20395976 gtgagcggtttcctaggttgtttgatctttctgagaacaaatccatttcggtcgcaggtttgttctctct 20395907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 30 - 174
Target Start/End: Original strand, 10563002 - 10563146
Alignment:
30 gtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggttgtttga 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||  || ||||||||||| ||||||||||| ||||||  ||||||||||||||||||    
10563002 gtgtgtctaagaagttgggggatggttcagacactttgttttggtacgataagtggttaggttcggtttctttttgtgagcagtttcctaggttgtttga 10563101  T
130 tcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    |||| ||||||||||| | |||||||||||||| || ||||||||    
10563102 tctttctgagaacaaacccattacggtggcaggtttgttctctct 10563146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 251 - 369
Target Start/End: Original strand, 10563201 - 10563319
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||||||| || ||| || ||||||||||||||||||||||||    
10563201 tgtagggctttattgactgatgtttctctgcaagattttgttttagacaggtgggtgtggttgccagatcctattcagggttacactgttcgcggttctt 10563300  T
351 atcacttgttgacttcaaa 369  Q
    |||||||||||||||||||    
10563301 atcacttgttgacttcaaa 10563319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 251 - 364
Target Start/End: Complemental strand, 20395844 - 20395731
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
20395844 tgtagggctttattgactgatgtttctttgcaagattttgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgtggttctt 20395745  T
351 atcacttgttgact 364  Q
    ||||| || |||||    
20395744 atcacatgctgact 20395731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 253 - 369
Target Start/End: Complemental strand, 53780291 - 53780175
Alignment:
253 tagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttcttat 352  Q
    |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| || ||| || |||||||||||||||||||||| |||    
53780291 tagggctttattgactgatgtttctctgcaagattttgtttcagacaggtgggtgtggttgccagatcctattcagggttacactgttcgcggttcatat 53780192  T
353 cacttgttgacttcaaa 369  Q
    |||||||||||||||||    
53780191 cacttgttgacttcaaa 53780175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 26 - 161
Target Start/End: Complemental strand, 42778711 - 42778576
Alignment:
26 gagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggttgt 125  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||| ||||| |||||| |||||||||||||||    
42778711 gagtgtgtgtctaagaagttggggaatggttcagacactttgttttggtttgataaatggttagggtcggtgtctttttgtgagcggtttcctaggttgt 42778612  T
126 ttgatcttgctgagaacaaatctattacggtggcag 161  Q
    | |||||  ||| ||| ||||  ||| |||||||||    
42778611 tcgatctctctgtgaataaattcatttcggtggcag 42778576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 251 - 354
Target Start/End: Complemental strand, 42778486 - 42778383
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| |||||||||||||||||| |||||| |||||||||||| |||||||| |||||||| || ||| ||| ||||||| ||||||||||||| |    
42778486 tgtagggccttattgactgatgtttctttgcaagattctgtttcagataggtgggtttggttgccagatcctattgtgggttactctgttcgcggttcat 42778387  T
351 atca 354  Q
    ||||    
42778386 atca 42778383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 251 - 366
Target Start/End: Original strand, 53486845 - 53486960
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| |||||||||||||||||| ||| || || ||||||||||||||| ||||||||||| |||||| ||| ||||||| ||||||| ||||| |    
53486845 tgtagggccttattgactgatgtttctttgcgagattttgtttcagacaggtgagtgtggttgccagaccctattgtgggttactctgttcgtggttcat 53486944  T
351 atcacttgttgacttc 366  Q
    ||||| || |||||||    
53486945 atcacatgctgacttc 53486960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 251 - 366
Target Start/End: Original strand, 30273704 - 30273819
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| ||||||| |||| ||| | |||||| || ||||||||||||||||||||||||||| |||||| ||| ||||||| ||||||| ||||| |    
30273704 tgtagggccttattgattgatatttttttgcaagattttgtttcagacaggtgggtgtggttgccagacccttttgtgggttactctgttcgtggttcat 30273803  T
351 atcacttgttgacttc 366  Q
    ||||| || |||||||    
30273804 atcacatgctgacttc 30273819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 251 - 366
Target Start/End: Original strand, 34322211 - 34322326
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||| || |||||||||||||||||| |||||| || |||||| |||||||||||||||||||| |||||| | | ||||||| ||||||| ||||| |    
34322211 tgtagagccttattgactgatgtttctttgcaagattttgtttccgacaggtgggtgtggttgccagaccctttggtgggttactctgttcgtggttcat 34322310  T
351 atcacttgttgacttc 366  Q
    ||||| || |||||||    
34322311 atcacatgctgacttc 34322326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 23 - 102
Target Start/End: Original strand, 53486600 - 53486679
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttcttt 102  Q
    ||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||| ||||||||| | |||||||||||    
53486600 ggggagtgtgtgtctaagatgttgggggatggctcagacactttgttttggtatgataagtggttatgatcggtttcttt 53486679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 251 - 355
Target Start/End: Original strand, 18106448 - 18106552
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| |||||||||||||||||| |||||| || |||||| |||||||||||||||||||| |||||| | | ||||||| ||||||  ||||| |    
18106448 tgtagggccttattgactgatgtttctttgcaagattttgtttccgacaggtgggtgtggttgccagaccctttggtgggttactctgttcttggttcat 18106547  T
351 atcac 355  Q
    |||||    
18106548 atcac 18106552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 105 - 161
Target Start/End: Original strand, 53486699 - 53486755
Alignment:
105 gtgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcag 161  Q
    ||||| |||||||||||||||| |||||| ||||||||||||| |||||| ||||||    
53486699 gtgagcggtttcctaggttgttcgatctttctgagaacaaatccattacgatggcag 53486755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 79
Target Start/End: Original strand, 29553406 - 29553460
Alignment:
25 ggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgac 79  Q
    ||||||||||||||||||  ||||||| ||  | |||||||||||||||||||||    
29553406 ggagtgtgtgtctaagaaagtgggggacgggaccgacactttgttttggtttgac 29553460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 5 - 174
Target Start/End: Complemental strand, 182609 - 182440
Alignment:
5 tatggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgt 104  Q
    |||||||| || || || ||||||||||||||||||||||||||||||||||||||||| ||||||||||  || ||||||||||| ||||| ||||| |    
182609 tatggtggaggttggtttggggagtgtgtgtctaagaagttgggggatggttcagacacgttgttttggtacgaaaagtggttaggatcggtctcttttt 182510  T
105 gtgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||| ||||||||||||||||||||||| ||||||||||||| ||| |||| ||||| || ||||||||    
182509 gtgagcggtttcctaggttgtttgatctttctgagaacaaatccatttcggtcgcaggtttgttctctct 182440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 251 - 364
Target Start/End: Complemental strand, 182377 - 182264
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
182377 tgtagggctttattgactgatgtttctttgcaagattttgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgtggttctt 182278  T
351 atcacttgttgact 364  Q
    ||||| || |||||    
182277 atcacatgctgact 182264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 96; Significance: 5e-47; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 17659323 - 17659168
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | ||||||||| ||||||||||| |||    
17659323 tggtggaggctggtttggggagtgtgtgtctaagaagttgggggatggttcagatactttgttttggtttgataggtggttaggttcggtttctttctgt 17659224  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcagg 162  Q
    ||| ||||||||||||||| |||||||  |||||||||||  ||||| ||||||||    
17659223 gagaggtttcctaggttgtatgatctttttgagaacaaatacattacagtggcagg 17659168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 251 - 369
Target Start/End: Complemental strand, 23680410 - 23680292
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||||||||||||||||||||||| ||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |    
23680410 tgtagggctttattgactgatgtttctttgctagattctgtttcagacaggtgggtgtggttgccagaccctgttgagggttacactgttcgcggttcat 23680311  T
351 atcacttgttgacttcaaa 369  Q
    ||||| || ||||| ||||    
23680310 atcacctgctgactacaaa 23680292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 25 - 174
Target Start/End: Original strand, 45255495 - 45255644
Alignment:
25 ggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggttg 124  Q
    ||||||||||| ||||||| ||||||||||||| || ||||||||||||| ||| ||||||||||| || ||||| ||  ||||| |||| |||||||||    
45255495 ggagtgtgtgtttaagaaggtgggggatggttccgatactttgttttggtatgataagtggttaggatcagtttcgtttcgtgagaggttccctaggttg 45255594  T
125 tttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||||||| ||||||| ||||| ||| |||||||||| || ||||||||    
45255595 tttgatctttctgagaataaatccatttcggtggcaggtttgttctctct 45255644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 253 - 369
Target Start/End: Original strand, 45255722 - 45255838
Alignment:
253 tagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttcttat 352  Q
    ||||| ||| ||| ||||||||||| |||||| || ||||||||||||||||||||||||||| |||||| ||||||| || ||||||||||||||||||    
45255722 tagggttttgttggctgatgtttctttgcaagattttgtttcagacaggtgggtgtggttgccagaccctattgagggctatactgttcgcggttcttat 45255821  T
353 cacttgttgacttcaaa 369  Q
    |||||| ||||| ||||    
45255822 cacttgctgactacaaa 45255838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 251 - 364
Target Start/End: Complemental strand, 17659079 - 17658966
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    ||||||| ||||||||||||||||||||||| || || |||||| ||||||||||||||||||| ||||||| ||||||||||||||||| | ||||| |    
17659079 tgtagggttttattgactgatgtttctctgctagattttgtttctgacaggtgggtgtggttgcttgaccctattgagggttacactgtttgtggttcat 17658980  T
351 atcacttgttgact 364  Q
    |||  |||||||||    
17658979 atcgtttgttgact 17658966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 7 - 146
Target Start/End: Complemental strand, 36157647 - 36157508
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || ||||||| ||||||||||||||||||||||||||  || ||| ||||||||||||| ||||||||||| |||| | ||||||||    
36157647 tggtggaggctggtttggggagtctgtgtctaagaagttgggggatggtttcgatactctgttttggtttgataagtggttaggatcggctactttgtgt 36157548  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaat 146  Q
    | | ||| |||| | ||||||| |||| | ||||||||||    
36157547 gtgaggtatcctcgattgtttgctctttccgagaacaaat 36157508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 69 - 147
Target Start/End: Complemental strand, 23680592 - 23680514
Alignment:
69 tttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggttgtttgatcttgctgagaacaaatc 147  Q
    |||||| ||| | ||||||||| |||||||||||  ||||| |||||||||||||||| |||||| |||||||||||||    
23680592 tttggtatgataggtggttaggatcggtttcttttcgtgagcggtttcctaggttgttcgatctttctgagaacaaatc 23680514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0912 (Bit Score: 94; Significance: 8e-46; HSPs: 1)
Name: scaffold0912
Description:

Target: scaffold0912; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 5 - 174
Target Start/End: Original strand, 2519 - 2688
Alignment:
5 tatggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgt 104  Q
    |||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||| ||||||||||| || || ||||| |    
2519 tatggtggaggctggtttggggagtgtgtgtctaagaagttgggggatggttcagacacgttgttctggtatgataagtggttaggatcagtctcttttt 2618  T
105 gtgagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    ||||| |||||||||||||||||||| || ||||||||||||| ||| | |||||||| || ||||||||    
2619 gtgagcggtttcctaggttgtttgatgtttctgagaacaaatccatttcagtggcaggtttgttctctct 2688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 89; Significance: 8e-43; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 7 - 159
Target Start/End: Complemental strand, 4077767 - 4077615
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||||||||| || |||||| ||||||| ||  |||||||||||||||||||||| |||||||||| ||| ||||||||||| |||||| |||| |||    
4077767 tggtggtggctggtttggggagagtgtgtcgaaacagttgggggatggttcagacaccttgttttggtatgataagtggttaggatcggttcctttttgt 4077668  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaatctattacggtggc 159  Q
    ||| |||||||| |||||||||||||| ||||||||||||| |||||||||||    
4077667 gagcggtttcctcggttgtttgatctttctgagaacaaatccattacggtggc 4077615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 23 - 174
Target Start/End: Complemental strand, 34232175 - 34232024
Alignment:
23 ggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggt 122  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||| |||||||||||||||||| ||||| |||| |    
34232175 ggggagtgtgtgtctaagaagttgggggatggttctgacactttgttttggtatgataagtggttaggatcggtttctttgtgtgagcggttttctagat 34232076  T
123 tgtttgatcttgctgagaacaaatctattacggtggcaggatttttctctct 174  Q
    |||| |||||| ||||||| || || ||| |||||||||  || ||||||||    
34232075 tgttcgatctttctgagaataagtccatttcggtggcagacttgttctctct 34232024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 251 - 369
Target Start/End: Original strand, 7458563 - 7458681
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||||||||| ||| ||||||||||||||| ||||||||| |||||||||||||||||||| || ||| || ||||||||||||||||||||||||    
7458563 tgtagggctttattaactaatgtttctctgcaagattctgtttccgacaggtgggtgtggttgccagatcctattcagggttacactgttcgcggttctt 7458662  T
351 atcacttgttgacttcaaa 369  Q
    |||||||||||||||||||    
7458663 atcacttgttgacttcaaa 7458681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 251 - 369
Target Start/End: Complemental strand, 4077523 - 4077405
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||||||||||  |||||| ||| |||||| || ||| ||||||||||||||||||||||  ||||||| |||||| || || |||||||||||||    
4077523 tgtagggctttattgtttgatgtgtctttgcaagattttgtgtcagacaggtgggtgtggttgctagaccctgctgagggctatacagttcgcggttctt 4077424  T
351 atcacttgttgacttcaaa 369  Q
    |||||||||||||| ||||    
4077423 atcacttgttgactacaaa 4077405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 251 - 366
Target Start/End: Complemental strand, 34231947 - 34231832
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| ||||||| |||||||||| |||||| || |||||| |||||||||||||||||||| |||||| | |  |||||| ||||||| ||||| |    
34231947 tgtagggccttattgaatgatgtttctttgcaagattttgtttccgacaggtgggtgtggttgccagaccctttggtaggttactctgttcgtggttcat 34231848  T
351 atcacttgttgacttc 366  Q
    ||||| || |||||||    
34231847 atcacatgctgacttc 34231832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 79
Target Start/End: Original strand, 27941160 - 27941214
Alignment:
25 ggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgac 79  Q
    ||||||||||||||||||  ||||||| ||  | |||||||||||||||||||||    
27941160 ggagtgtgtgtctaagaaagtgggggacgggaccgacactttgttttggtttgac 27941214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 81; Significance: 5e-38; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 26 - 146
Target Start/End: Complemental strand, 1380555 - 1380435
Alignment:
26 gagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtgagtggtttcctaggttgt 125  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||| ||||| |||||| |||||||||||||||    
1380555 gagtgtgtgtctaagaagttggggaatggttcagacactttgttttggtttgataaatggttagggtcggtgtctttttgtgagcggtttcctaggttgt 1380456  T
126 ttgatcttgctgagaacaaat 146  Q
    | |||||  ||| ||||||||    
1380455 tcgatctctctgtgaacaaat 1380435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 251 - 355
Target Start/End: Original strand, 2999640 - 2999744
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||||||| |||||||||||||||||| |||||| || |||||| |||||||||||||||||||| |||||| | | ||||||| ||||||  ||||| |    
2999640 tgtagggccttattgactgatgtttctttgcaagattttgtttccgacaggtgggtgtggttgccagaccctttggtgggttactctgttcttggttcat 2999739  T
351 atcac 355  Q
    |||||    
2999740 atcac 2999744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 251 - 354
Target Start/End: Complemental strand, 1380330 - 1380227
Alignment:
251 tgtagggctttattgactgatgtttctctgcaagtttctgtttcagacaggtgggtgtggttgcctgaccctgttgagggttacactgttcgcggttctt 350  Q
    |||| ||| |||||||||||||||||| |||||| || ||||||||| |||||||| |||||||| || ||| ||| ||||||| ||||||||||||| |    
1380330 tgtaaggccttattgactgatgtttctttgcaagattatgtttcagataggtgggtttggttgccagatcctattgtgggttactctgttcgcggttcat 1380231  T
351 atca 354  Q
    ||||    
1380230 atca 1380227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 7 - 146
Target Start/End: Complemental strand, 11028362 - 11028223
Alignment:
7 tggtggtggctgattaggggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgt 106  Q
    |||||| ||||| || ||||||| |||||| |||||||||||| ||||||  || ||| | ||||||||||| |||||||||||||||| | |||||| |    
11028362 tggtggaggctggtttggggagtctgtgtcgaagaagttggggcatggtttcgatactctattttggtttgataagtggttagggtcggctgctttgttt 11028263  T
107 gagtggtttcctaggttgtttgatcttgctgagaacaaat 146  Q
    | | ||| ||||  | |||||| |||| | ||||||||||    
11028262 gtgaggtatcctcagctgtttgctctttccgagaacaaat 11028223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 107
Target Start/End: Original strand, 25381050 - 25381132
Alignment:
25 ggagtgtgtgtctaagaagttgggggatggttcagacactttgttttggtttgacaagtggttagggtcggtttctttgtgtg 107  Q
    ||||| |||||| || ||| ||||||||||  | ||||| |||||||||||||| || ||||| ||||| ||| |||||||||    
25381050 ggagtatgtgtcgaaaaaggtgggggatggaactgacacattgttttggtttgataaatggttggggtcagttcctttgtgtg 25381132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University