View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6911_low_13 (Length: 393)
Name: NF6911_low_13
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6911_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 27 - 371
Target Start/End: Complemental strand, 5174391 - 5174047
Alignment:
| Q |
27 |
tacttagttgttttatggttacatttaaacataaattatcctaggatctatatcatcgttcttaaaggtggtaacgtgagagccaaggattattgtagac |
126 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174391 |
tacttagttgttttatggttacattaaaacataaattatcctaggatctatatcatcgttcttaaaggtggtaacgtgagagccaaggattattgtagac |
5174292 |
T |
|
| Q |
127 |
ctattcatatgtcattatttgccttcatttattttataattaaagttctaaattggggactataaccatattataatgtaacaaacaatcaaaacaggac |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174291 |
ctattcatatgtcattatttgccttcatttattttataattaaagttctaaattggggactaaaaccatattataatgtaacaaacaatcaaaacaggac |
5174192 |
T |
|
| Q |
227 |
aacttttgcataagattatcagtttgtcaccttttcataactgctatgcgatgataatataacataattagttgtccaaaacactacacaacatatatta |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5174191 |
aacttttgcataagattatcagtttgtcaccttttcataactgctatgcgatgataatataacataattagttgtccaaaacactacataacatatatta |
5174092 |
T |
|
| Q |
327 |
atttcataacaatacagcttgtctcctttgtaaaacctttaactt |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174091 |
atttcataacaatacagcttgtctcctttgtaaaacctttaactt |
5174047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University