View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6911_low_16 (Length: 369)
Name: NF6911_low_16
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6911_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 11 - 354
Target Start/End: Original strand, 8022336 - 8022679
Alignment:
| Q |
11 |
gatggacatcatggttgacatgatctctagcatttaacaaaccaaccaaaacatgttcagcagaagcatgttttgtgcttccaacaccctgtttctctga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022336 |
gatggacatcatggttgacatgatctctagcatttagcaaaccaaccaaaacatgttcagcagaagcatgttttgtgcttccaacaccctgtttctctga |
8022435 |
T |
|
| Q |
111 |
ttctcccaacaataccgcaagttctttctttgatatctttattttcaccttaccattagcatcagaagaagctcttagtgcacctaaaagcttctctttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022436 |
ttctcccaacaataccgcaagttctttctttgatatctttattttcaccttaccattagcatcagaagaagctcttagtgcacctaaaagcttctctttc |
8022535 |
T |
|
| Q |
211 |
tctatgttccccaaactcaaaccatgaacttcatcaaaaactttgcttgaattcatcctactcttatggtttgatgtcagtgatccccaatcttctccgg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022536 |
tctatgttccccaaactcaaaccatgaacttcatcaaaaactttgcttgaattcatcctactcttatggtttgatgtcagtgatccccaatcttctccgg |
8022635 |
T |
|
| Q |
311 |
cccactccatcgaagacgatgtgcaacaatttcccatatatatt |
354 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8022636 |
cccactccatcgaagatgatgtgcaacaatttcccatatatatt |
8022679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University