View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6911_low_17 (Length: 366)
Name: NF6911_low_17
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6911_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 1 - 336
Target Start/End: Original strand, 401734 - 402069
Alignment:
| Q |
1 |
tcagttgtcacagatatgaaactgaatataggacatcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401734 |
tcagttgtcacagatatgaaactgaatataggacatcacagccctctcccattccagcacaacagccacatcccatagccataggcgctatattggcaag |
401833 |
T |
|
| Q |
101 |
acttcagaggtttgttccacctgaaagggttcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcat |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401834 |
acttcagaggtttgttccatctgaaagggttcgaagattgagacctataatgtttcgttgaatgaaatctccgaaaaccagcaaatatttattctggcat |
401933 |
T |
|
| Q |
201 |
ctcataaatacaatctcgattttattcccagttaaaccagccggcttcaagcaattgagagagnnnnnnnnggtcttccaacacccttcaaacacagaaa |
300 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
401934 |
ctcataaatacaatctcgattttatccacagttaaaccagccggcttcaagcaattgagagagttttttttggtcttccaacacccttcaaacacagaaa |
402033 |
T |
|
| Q |
301 |
ccaattgtttgggttagcagcctcccagcacaccat |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
402034 |
ccaattgtttgggttagcagcctcccagcacaccat |
402069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University