View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6911_low_31 (Length: 258)
Name: NF6911_low_31
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6911_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 23 - 119
Target Start/End: Complemental strand, 55060837 - 55060741
Alignment:
| Q |
23 |
agctacttatgaaagagaggtttgtcctggtgagattgtggttgtggataaaagtggtgttcaatctcattgtcttgtttctcgtccagaaccaaaa |
119 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55060837 |
agctacttatgaaagagaggtttatcctggtgagattgtggttgtggataaaagtggtgttcaatctcattgtcttgtttctcgtccagaaccaaaa |
55060741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 170 - 242
Target Start/End: Complemental strand, 55060688 - 55060615
Alignment:
| Q |
170 |
ggaaatctgtttatgaatcaagaacatggtttggtgaaatattggctact-aagagttctgttgattgtgatgt |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
55060688 |
ggaaatctgtttatgaatcaagaagatggtttggtgaaatattggctactaaagagtcctgttgattgtgatgt |
55060615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University