View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6911_low_37 (Length: 244)
Name: NF6911_low_37
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6911_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43132075 - 43132301
Alignment:
| Q |
1 |
tcgaatgattttagtggcgaaattcaaacacatttaatcatgtgatgtaaatttgtttaggtgacaaagcatgaggatgcaccagaaggtgaatggaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43132075 |
tcgaatgattttagtggcgaaattcaaacacatttaatcatgtgatgtaaatttgtttaggtgacaaagcatgaggatgcaccagaaggtgaatggaaag |
43132174 |
T |
 |
| Q |
101 |
gatggaattggagatcagaaggggatttattgataaatggtgcattttttacaccatctggagcaggaggagcatcatcaagctatgcaagagcatcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43132175 |
gatggaattggagatcagaaggggatttattgataaatggtgcattttttacaccatcaggagcaggaggagcatcatcaagctatgcaagagcatcaag |
43132274 |
T |
 |
| Q |
201 |
tttaagtgcaagaccatcttctctagt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43132275 |
tttaagtgcaagaccatcttctctagt |
43132301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 59 - 222
Target Start/End: Complemental strand, 34287642 - 34287482
Alignment:
| Q |
59 |
aggtgacaaagcatgaggatgcaccagaaggtgaatggaaaggatggaattggagatcagaaggggatttattgataaatggtgcattttttacaccatc |
158 |
Q |
| |
|
||||||||||| |||| |||||| |||| |||||||||| ||||||||||| |||||||| || ||| || |||||||||||||||| || ||| |
|
|
| T |
34287642 |
aggtgacaaagtatgaagatgcagcagagagtgaatggaagcattggaattggaggtcagaaggagacttaatggtaaatggtgcatttttcactaaatc |
34287543 |
T |
 |
| Q |
159 |
tggagcaggaggagcatcatcaagctatgcaagagcatcaagtttaagtgcaagaccatcttct |
222 |
Q |
| |
|
|| | | ||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
34287542 |
aggtg---gtggagcatcatctagctatgcaagagcttcaagcttaagtgcaagaccatcttct |
34287482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University