View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6911_low_40 (Length: 240)

Name: NF6911_low_40
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6911_low_40
NF6911_low_40
[»] chr5 (1 HSPs)
chr5 (19-110)||(20703399-20703490)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 20703399 - 20703490
Alignment:
19 tagtaccttggagggttcattctcctaaagagtttctcatattcatcatccatgtaatgagactgagaatagctcatgttgacttcagaaat 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20703399 tagtaccttggagggttcattctcctaaagagtttctcatattcatcatccatgtaatgagactgagaatagctcatgttgacttcagaaat 20703490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University