View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6911_low_42 (Length: 225)

Name: NF6911_low_42
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6911_low_42
NF6911_low_42
[»] chr8 (16 HSPs)
chr8 (1-225)||(22081062-22081286)
chr8 (1-198)||(44562932-44563132)
chr8 (1-198)||(9354453-9354653)
chr8 (1-198)||(19659223-19659423)
chr8 (32-225)||(19286266-19286459)
chr8 (74-225)||(31490013-31490164)
chr8 (74-225)||(19674239-19674390)
chr8 (74-225)||(28362218-28362369)
chr8 (71-153)||(19687971-19688053)
chr8 (71-156)||(16277424-16277509)
chr8 (71-156)||(27609165-27609250)
chr8 (71-159)||(18710453-18710541)
chr8 (74-225)||(19208623-19208774)
chr8 (74-225)||(33258524-33258675)
chr8 (71-156)||(2137519-2137604)
chr8 (119-156)||(19518451-19518488)
[»] chr4 (25 HSPs)
chr4 (1-225)||(15391563-15391788)
chr4 (1-225)||(14235750-14235980)
chr4 (1-225)||(15285153-15285380)
chr4 (1-225)||(15227689-15227916)
chr4 (1-225)||(1900076-1900303)
chr4 (74-225)||(5005686-5005837)
chr4 (74-225)||(30753558-30753709)
chr4 (71-225)||(21969517-21969671)
chr4 (71-225)||(27163618-27163772)
chr4 (74-225)||(33674114-33674265)
chr4 (74-225)||(39850439-39850590)
chr4 (1-198)||(24460830-24461030)
chr4 (32-225)||(54833206-54833399)
chr4 (71-225)||(24592612-24592766)
chr4 (71-156)||(17013885-17013970)
chr4 (119-225)||(14098357-14098463)
chr4 (119-225)||(31126867-31126973)
chr4 (71-156)||(14664903-14664988)
chr4 (71-159)||(14763605-14763693)
chr4 (119-219)||(18800971-18801071)
chr4 (71-159)||(24112547-24112635)
chr4 (71-159)||(34189258-34189346)
chr4 (74-225)||(40105942-40106093)
chr4 (74-156)||(6569738-6569820)
chr4 (119-159)||(19373143-19373183)
[»] scaffold0109 (1 HSPs)
scaffold0109 (1-225)||(21368-21592)
[»] chr2 (40 HSPs)
chr2 (54-218)||(27392797-27392961)
chr2 (1-225)||(19456635-19456862)
chr2 (1-198)||(31891542-31891742)
chr2 (1-225)||(21703378-21703605)
chr2 (2-198)||(27118515-27118714)
chr2 (71-225)||(32049595-32049749)
chr2 (1-198)||(34156838-34157038)
chr2 (1-198)||(34303517-34303717)
chr2 (74-225)||(11635482-11635633)
chr2 (74-225)||(11641671-11641822)
chr2 (1-198)||(3784481-3784681)
chr2 (1-198)||(16163426-16163626)
chr2 (74-225)||(261058-261209)
chr2 (74-225)||(12586598-12586749)
chr2 (74-225)||(21677475-21677626)
chr2 (71-225)||(34279246-34279400)
chr2 (74-225)||(13936837-13936988)
chr2 (119-225)||(12716943-12717049)
chr2 (71-225)||(27434734-27434888)
chr2 (74-225)||(27803489-27803640)
chr2 (74-225)||(37925290-37925441)
chr2 (74-225)||(40233296-40233447)
chr2 (119-225)||(16829676-16829782)
chr2 (119-225)||(16891699-16891805)
chr2 (71-225)||(28882011-28882165)
chr2 (71-156)||(12655408-12655493)
chr2 (71-156)||(20837784-20837869)
chr2 (71-156)||(23128856-23128941)
chr2 (1-33)||(27392964-27392996)
chr2 (74-225)||(19416792-19416943)
chr2 (74-225)||(27777004-27777155)
chr2 (74-225)||(27816771-27816922)
chr2 (74-225)||(31876078-31876229)
chr2 (74-225)||(34861477-34861628)
chr2 (74-225)||(37686202-37686353)
chr2 (74-225)||(37701467-37701618)
chr2 (71-225)||(34286151-34286305)
chr2 (71-225)||(34291211-34291365)
chr2 (119-225)||(39889859-39889965)
chr2 (74-159)||(39052121-39052206)
[»] chr1 (7 HSPs)
chr1 (1-225)||(16208256-16208480)
chr1 (54-225)||(20460908-20461079)
chr1 (1-198)||(20340560-20340760)
chr1 (72-225)||(41793610-41793763)
chr1 (74-225)||(28584781-28584932)
chr1 (74-225)||(10962470-10962621)
chr1 (119-225)||(51638018-51638124)
[»] chr6 (28 HSPs)
chr6 (2-225)||(20160502-20160728)
chr6 (2-225)||(22172103-22172329)
chr6 (1-198)||(28162485-28162685)
chr6 (1-225)||(22477441-22477671)
chr6 (1-198)||(8892478-8892678)
chr6 (1-198)||(13522241-13522441)
chr6 (1-198)||(33374424-33374624)
chr6 (71-225)||(26918178-26918332)
chr6 (1-198)||(8903713-8903913)
chr6 (74-225)||(3695861-3696012)
chr6 (74-225)||(34463608-34463759)
chr6 (71-225)||(26999871-27000025)
chr6 (119-225)||(30558308-30558414)
chr6 (32-225)||(4525087-4525280)
chr6 (74-225)||(16673925-16674076)
chr6 (71-225)||(26988799-26988953)
chr6 (71-156)||(13299195-13299280)
chr6 (71-156)||(15424561-15424646)
chr6 (71-156)||(16749721-16749806)
chr6 (71-108)||(22935121-22935158)
chr6 (71-108)||(23857566-23857603)
chr6 (71-159)||(29549342-29549430)
chr6 (74-225)||(16944274-16944425)
chr6 (74-225)||(29572811-29572962)
chr6 (71-225)||(24304862-24305016)
chr6 (119-225)||(26777919-26778025)
chr6 (119-225)||(27007510-27007616)
chr6 (71-156)||(24863584-24863669)
[»] chr3 (42 HSPs)
chr3 (1-225)||(16626772-16626999)
chr3 (1-225)||(18530159-18530380)
chr3 (71-225)||(7996324-7996478)
chr3 (71-225)||(10642832-10642986)
chr3 (1-198)||(17994050-17994250)
chr3 (74-225)||(28116302-28116453)
chr3 (74-225)||(47023215-47023366)
chr3 (1-198)||(4625736-4625936)
chr3 (74-225)||(11110706-11110857)
chr3 (74-225)||(51781773-51781924)
chr3 (74-225)||(51796862-51797013)
chr3 (71-225)||(4721393-4721547)
chr3 (71-225)||(7072974-7073128)
chr3 (1-198)||(5652179-5652379)
chr3 (74-225)||(20577207-20577358)
chr3 (74-225)||(29665330-29665481)
chr3 (74-225)||(36997434-36997585)
chr3 (71-225)||(4796995-4797149)
chr3 (80-198)||(5713016-5713134)
chr3 (80-198)||(5723926-5724044)
chr3 (80-198)||(5757433-5757551)
chr3 (80-198)||(5768324-5768442)
chr3 (71-225)||(6192078-6192232)
chr3 (119-225)||(17985346-17985452)
chr3 (71-225)||(35880528-35880682)
chr3 (32-225)||(8211503-8211696)
chr3 (74-159)||(48465743-48465828)
chr3 (74-225)||(5013474-5013625)
chr3 (74-225)||(18224953-18225104)
chr3 (119-225)||(5466747-5466853)
chr3 (71-225)||(15741424-15741578)
chr3 (119-225)||(22871264-22871370)
chr3 (119-225)||(22886323-22886429)
chr3 (71-156)||(8295806-8295891)
chr3 (71-159)||(4893041-4893129)
chr3 (71-159)||(18277394-18277482)
chr3 (71-159)||(18292695-18292783)
chr3 (71-159)||(18307996-18308084)
chr3 (71-159)||(32438985-32439073)
chr3 (74-225)||(24327921-24328072)
chr3 (119-225)||(6542864-6542970)
chr3 (119-156)||(29149145-29149182)
[»] chr7 (23 HSPs)
chr7 (1-225)||(16450109-16450336)
chr7 (1-225)||(16041128-16041355)
chr7 (1-198)||(31088575-31088775)
chr7 (1-198)||(45733292-45733492)
chr7 (74-225)||(3445096-3445247)
chr7 (74-225)||(5147530-5147681)
chr7 (71-225)||(5127794-5127948)
chr7 (71-225)||(16503567-16503721)
chr7 (71-225)||(16518603-16518757)
chr7 (74-225)||(11441362-11441513)
chr7 (74-225)||(45387145-45387296)
chr7 (74-159)||(26435125-26435210)
chr7 (41-225)||(2154375-2154559)
chr7 (71-225)||(4145310-4145464)
chr7 (74-159)||(26485934-26486019)
chr7 (74-159)||(26538063-26538148)
chr7 (71-159)||(5159390-5159478)
chr7 (74-225)||(9618453-9618604)
chr7 (74-225)||(24592731-24592882)
chr7 (74-225)||(26275284-26275435)
chr7 (74-225)||(26320059-26320210)
chr7 (71-225)||(11424963-11425117)
chr7 (71-156)||(10917052-10917137)
[»] scaffold0260 (1 HSPs)
scaffold0260 (1-198)||(2883-3083)
[»] chr5 (41 HSPs)
chr5 (1-221)||(22888287-22888510)
chr5 (1-225)||(23892016-23892246)
chr5 (1-198)||(13184770-13184970)
chr5 (1-198)||(13440616-13440816)
chr5 (1-198)||(33877087-33877287)
chr5 (74-225)||(8665676-8665827)
chr5 (2-156)||(24969903-24970057)
chr5 (1-198)||(11325634-11325834)
chr5 (74-225)||(18500949-18501100)
chr5 (74-225)||(30168279-30168430)
chr5 (1-159)||(25198908-25199069)
chr5 (74-219)||(43078065-43078210)
chr5 (74-218)||(31431245-31431389)
chr5 (119-225)||(18375658-18375764)
chr5 (71-225)||(22999312-22999466)
chr5 (119-225)||(24681247-24681353)
chr5 (119-225)||(24723774-24723880)
chr5 (119-225)||(33516166-33516272)
chr5 (71-225)||(33777297-33777451)
chr5 (71-156)||(9548741-9548826)
chr5 (74-225)||(30151828-30151979)
chr5 (28-159)||(33292404-33292535)
chr5 (74-225)||(37754778-37754929)
chr5 (74-225)||(40473753-40473904)
chr5 (71-153)||(11549236-11549318)
chr5 (71-225)||(23718186-23718340)
chr5 (71-225)||(23752648-23752802)
chr5 (74-225)||(3789336-3789487)
chr5 (74-225)||(5637720-5637871)
chr5 (74-225)||(9317261-9317412)
chr5 (74-225)||(12131965-12132116)
chr5 (74-225)||(15759058-15759209)
chr5 (74-225)||(26480202-26480353)
chr5 (74-225)||(29967267-29967418)
chr5 (74-225)||(30029225-30029376)
chr5 (74-225)||(31826620-31826771)
chr5 (74-225)||(37771200-37771351)
chr5 (71-225)||(15658958-15659112)
chr5 (119-156)||(28649105-28649142)
chr5 (71-156)||(30934515-30934600)
chr5 (74-155)||(41674589-41674670)
[»] scaffold0124 (2 HSPs)
scaffold0124 (54-225)||(20213-20384)
scaffold0124 (71-156)||(30323-30408)
[»] scaffold0029 (1 HSPs)
scaffold0029 (71-225)||(431-585)
[»] scaffold0237 (1 HSPs)
scaffold0237 (119-225)||(15279-15385)
[»] scaffold0143 (1 HSPs)
scaffold0143 (71-156)||(27162-27247)
[»] scaffold0496 (1 HSPs)
scaffold0496 (74-225)||(37-188)
[»] scaffold0144 (1 HSPs)
scaffold0144 (74-225)||(26506-26657)
[»] scaffold0089 (2 HSPs)
scaffold0089 (71-156)||(47286-47371)
scaffold0089 (71-108)||(40370-40407)
[»] scaffold0415 (1 HSPs)
scaffold0415 (80-219)||(5796-5936)
[»] scaffold0350 (1 HSPs)
scaffold0350 (74-225)||(7543-7694)
[»] scaffold0336 (1 HSPs)
scaffold0336 (71-218)||(8040-8187)
[»] scaffold0558 (1 HSPs)
scaffold0558 (1-39)||(253-291)


Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 16)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 22081062 - 22081286
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||    
22081062 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccaacggctgttgctgcatttgctgagcaatggcattgacgggtacctgaggt 22081161  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |    
22081162 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatacggcggaggtagctgagcagcattga 22081261  T
201 tgggggcaacagtagccatggattg 225  Q
    |||||||||||||||||||||||||    
22081262 tgggggcaacagtagccatggattg 22081286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 44563132 - 44562932
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||| |   |||||| ||||||||||||    
44563132 tggtatcagaggaaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacggcggcattaacgggtacctga 44563033  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||| ||||   |||||   |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||| | || | |||||||||||||||||    
44563032 ggttgtcccg---atggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaggtagctgagcag 44562936  T
195 catt 198  Q
    ||||    
44562935 catt 44562932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 9354653 - 9354453
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
9354653 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 9354554  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
9354553 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 9354457  T
195 catt 198  Q
    ||||    
9354456 catt 9354453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 19659223 - 19659423
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | || ||||| || ||| ||||  | | |||||| ||||||||||||    
19659223 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggttgttgttgcattcgctggacgacggcattaacgggtacctga 19659322  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   ||| | || | |||||||||||||||||    
19659323 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaggtagctgagcag 19659419  T
195 catt 198  Q
    ||||    
19659420 catt 19659423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 225
Target Start/End: Complemental strand, 19286459 - 19286266
Alignment:
32 tgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaa 131  Q
    ||||||||||||||| |  |||| || || ||||  || ||||||||||||||||| || ||||||||||| ||||| | |   || ||||| |||||||    
19286459 tgctgctgctgttgaactggcggttgatgttgtacctgttgagcaatggcattgacaggaacctgaggttggcccggtggtaaagggtactgatgataaa 19286360  T
132 atggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | ||||||||||| ||||||||||||||  |||  ||  | |||| |||||| |  ||||| ||||| || || |||||||| |||||||||||    
19286359 acggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgagctgcattgataggagcaacagtggccatggattg 19286266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 31490013 - 31490164
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |     || ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |    
31490013 gcaatcgcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggt 31490112  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || ||||||||||||||||| |||||    
31490113 atgacggaggcatttgagctgcattgataggggcaacagtagccattgattg 31490164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 19674390 - 19674239
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || || || ||||||||||| || ||||||||||||||||| ||  |||| ||  | |    
19674390 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggt 19674291  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| ||||||||||||||    
19674290 atgacggaggcatttgagctgcattgataggagcaacggtagccatggattg 19674239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 28362218 - 28362369
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
28362218 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 28362317  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| ||||| ||||| ||||||||||||||    
28362318 atgacggaggcatttgagctgcattgatgggagcaacggtagccatggattg 28362369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 153
Target Start/End: Complemental strand, 19688053 - 19687971
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctg 153  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||||||||| ||||| || ||||||||||||||    
19688053 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactggtgatagaatggcggaaagaaaggatgctg 19687971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 16277509 - 16277424
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
16277509 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 16277424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 27609165 - 27609250
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
27609165 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 27609250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 18710541 - 18710453
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    |||||||  ||||||||||| ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
18710541 tgagcaactgcattgacgggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 18710453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 19208623 - 19208774
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
19208623 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 19208722  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
19208723 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 19208774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 33258675 - 33258524
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
33258675 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 33258576  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
33258575 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 33258524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 2137519 - 2137604
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||  || |||||||||||||||||    
2137519 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatgacggaaagaaaggatgctgaga 2137604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Original strand, 19518451 - 19518488
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| ||||||||||| ||||||||||||||||||||    
19518451 tactgatgataaaatggcgggaagaaaggatgctgaga 19518488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 25)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 15391563 - 15391788
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||    
15391563 tggtatcggaggaaaggtaggtctggtttgttgctgctgttgttgagccagcggctgttgctgcatttgctgagcaatggcattgatgggtacctgaggt 15391662  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |    
15391663 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatacggcggaggtagctgagcaacattga 15391762  T
201 tgggggc-aacagtagccatggattg 225  Q
    ||||||| ||||||||||||||||||    
15391763 tgggggcaaacagtagccatggattg 15391788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 14235750 - 14235980
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg------agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacc 94  Q
    ||||||| |||||||||||||||| | |||||| |||||||||||      |||| |||||||||| || |||||||||||||||||||| |||||||||    
14235750 tggtatcagaggaaaggtaggtctagcttgttgttgctgctgttgttgctgagccggcggctgttgttgcatttgctgagcaatggcattaacgggtacc 14235849  T
95 tgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    |  || |||||||  | | | || ||||| ||||| ||||||||||||||||||||||||||||||||||| ||||| || ||| |||||| ||||||||    
14235850 tatgggtgacccgatggtagagggtactgatgatagaatggtgggaagaaaggatgctgagagtattgcatatactggtacggcagaggtaactgagcag 14235949  T
195 cattaatgggggcaacagtagccatggattg 225  Q
    ||||||| |||| |||||| |||||||||||    
14235950 cattaataggggtaacagtggccatggattg 14235980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 15285153 - 15285380
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||||||||| |||||   ||   | |||||||| || ||||||||| | |||||||| ||||| ||||||    
15285153 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgttgttgagttggtggctgttgttgcatttgctgaacgatggcattaacgggcacctga 15285252  T
98 ggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcat 197  Q
    ||||||||||  | | | |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||  | ||    ||||||| ||| |||||||    
15285253 ggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatatgggtacaatggaggtaactgggcagcat 15285352  T
198 taatgggggcaacagtagccatggattg 225  Q
    |||| |||||||||||||||||||||||    
15285353 taataggggcaacagtagccatggattg 15285380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 15227916 - 15227689
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||||||||| |||||   |||  | |||||||| || ||||||||| | |  ||||| ||||||||||||    
15227916 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgttgttgagctggtggctgttgttgcatttgctgaacgacagcattaacgggtacctga 15227817  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   ||||| || ||||| |||||||| ||||| ||||||||||||||||||   ||| | || | |||||||| ||| ||||    
15227816 ggttgacccg---atggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggtacgacggaggtaactgggcag 15227720  T
195 cattaatgggggcaacagtagccatggattg 225  Q
    ||||||| |||||||||||||||||||||||    
15227719 cattaataggggcaacagtagccatggattg 15227689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 1900303 - 1900076
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctg---ctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||| || ||   ||||||| |  | |||||||| || ||||||||| | | |||||| ||||||||||||    
1900303 tggtatcggaggaaaggtaggtctagcttgttgatgttgttgctgttgaactggtggctgttgttgcatttgctgaacgacggcattaacgggtacctga 1900204  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||| ||   ||  | || | |||||||| ||| ||||    
1900203 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggcgcatatgggtacgacggaggtaactgggcag 1900107  T
195 cattaatgggggcaacagtagccatggattg 225  Q
    ||||||| |||||||||||||||||||||||    
1900106 cattaataggggcaacagtagccatggattg 1900076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 5005837 - 5005686
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
5005837 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 5005738  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| ||||| ||||| ||||||||||||||    
5005737 atgacggaggcatttgagctgcattgatgggagcaacggtagccatggattg 5005686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 30753709 - 30753558
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
30753709 gcaattgcattgacgggcacttgaggttgacccggcggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 30753610  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
30753609 atgacggaggcatttgagctgcattgataggtgcaacagtagccatggattg 30753558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 21969671 - 21969517
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| || |||||||||||||||||||| ||  |||| ||      
21969671 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggcgggaagaaaggatgctgagaatacggcatatatg 21969572  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | ||||||||||| |  ||||| ||||| ||||| |||||||||||||| |||||    
21969571 ggtatggcggaggcatttgagctgcattgatgggagcaacagtagccattgattg 21969517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 27163618 - 27163772
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||      
27163618 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatg 27163717  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| ||||| |||||||||||||| |||||    
27163718 ggtatgacggaggcatttgagctgcattgatgggagcaacagtagccattgattg 27163772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 33674114 - 33674265
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||||||||||||||| ||||||||||||||  |||||||  | |    
33674114 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaatggtgggaagaacggatgctgagagtacggcatgtatgggt 33674213  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| |||||    
33674214 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattg 33674265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 39850590 - 39850439
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||||||  | |    
39850590 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 39850491  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
39850490 atgacggaggcatttgagctgcattgataggtgcaacagtagccattgattg 39850439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 24460830 - 24461030
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
24460830 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 24460929  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||||||   | |||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
24460930 ggttgacc---cgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 24461026  T
195 catt 198  Q
    ||||    
24461027 catt 24461030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 225
Target Start/End: Complemental strand, 54833399 - 54833206
Alignment:
32 tgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaa 131  Q
    ||||||||||||||| |  |||| || || ||||  || ||||||||||||||||| || ||||||||||| ||||| | |   || ||||| |||||||    
54833399 tgctgctgctgttgaactggcggttgatgttgtacctgttgagcaatggcattgacaggaacctgaggttggcccggtggtaaagggtactgatgataaa 54833300  T
132 atggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | ||||||||||| ||||||||||||||  |||  ||  | |||| |||||| |  ||||| ||||| || || |||||||| |||||||||||    
54833299 acggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgagctgcattgataggagcaacagtggccatggattg 54833206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 24592612 - 24592766
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
24592612 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 24592711  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
24592712 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 24592766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 17013970 - 17013885
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
17013970 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 17013885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 14098463 - 14098357
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
14098463 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 14098364  T
219 tggattg 225  Q
    | |||||    
14098363 ttgattg 14098357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 31126867 - 31126973
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
31126867 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 31126966  T
219 tggattg 225  Q
    | |||||    
31126967 ttgattg 31126973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 14664988 - 14664903
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
14664988 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 14664903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 14763605 - 14763693
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
14763605 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 14763693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 219
Target Start/End: Original strand, 18800971 - 18801071
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
18800971 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 18801070  T
219 t 219  Q
    |    
18801071 t 18801071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 24112635 - 24112547
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
24112635 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 24112547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 34189258 - 34189346
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
34189258 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 34189346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 40105942 - 40106093
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
40105942 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 40106041  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
40106042 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 40106093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 156
Target Start/End: Complemental strand, 6569820 - 6569738
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| ||||| |||||||| |||||||||||||| |   | || ||||| || |||||||| || |||||||||||||||||    
6569820 gcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgaga 6569738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 159
Target Start/End: Complemental strand, 19373183 - 19373143
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| |||||||| ||||||||||| ||||||||||||||    
19373183 tactgatgataaaacggtgggaagaacggatgctgagagta 19373143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 21592 - 21368
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    ||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||| || ||||||||||||||||||||||||||||||||||||    
21592 tggtatcggaggaaaggtaggtctggtttgttgttgctgctgttaagccagcagctgttgttgcatttgctgagcaatggcattgacgggtacctgaggt 21493  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||| |    
21492 tgacccggcggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgcatgtactggtacggcggaggtagctgagaagcattga 21393  T
201 tgggggcaacagtagccatggattg 225  Q
    |||||||||||||||||| ||||||    
21392 tgggggcaacagtagccacggattg 21368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 40)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 54 - 218
Target Start/End: Complemental strand, 27392961 - 27392797
Alignment:
54 gctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctg 153  Q
    ||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||    
27392961 gctgttgttgcatttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggcggatactggtgatagaatggtgggaagaaaggatgctg 27392862  T
154 agagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    |||||||||||||||||| || || |||||||||||||||||||  |||||||||||||||||||    
27392861 agagtattgcatgtactggtacggtggaggtagctgagcagcatcgatgggggcaacagtagcca 27392797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 19456635 - 19456862
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||||||||| |||||   |||  | |||||||| || ||||||| | | |||||||| ||||| ||||||    
19456635 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgttgttgagctggtggctgttgttgcatttgctaaacgatggcattaacgggcacctga 19456734  T
98 ggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcat 197  Q
    ||||||||||  | | | |||||||| ||||| |||||||| ||||||||||||||| ||||||||   ||  | || | |||||||| ||| |||||||    
19456735 ggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgaaagtattgcgcatatgggtacgacggaggtaactgggcagcat 19456834  T
198 taatgggggcaacagtagccatggattg 225  Q
    |||| |||||||||||||||||||||||    
19456835 taataggggcaacagtagccatggattg 19456862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 31891542 - 31891742
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
31891542 tggtatcagaggaaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 31891641  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||| ||||   |||||   |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||| | || | |||||||||||||||||    
31891642 ggttgtcccg---atggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggaggtagctgagcag 31891738  T
195 catt 198  Q
    ||||    
31891739 catt 31891742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 21703378 - 21703605
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||| ||||||||||| | |||||| ||||| |||||   | |  | |||||||| || ||||| ||| | | |||||| ||||||||||||    
21703378 tggtatcggagggaaggtaggtctagcttgttgatgctgttgttgttgaactggtggctgttgttgcatttgttgaacgacggcattaacgggtacctga 21703477  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||| ||   ||  | || | |||||||| ||  ||||    
21703478 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggcgcatatgggtacgacggaggtaactaggcag 21703574  T
195 cattaatgggggcaacagtagccatggattg 225  Q
    ||||||| |||||||||||||||||||||||    
21703575 cattaataggggcaacagtagccatggattg 21703605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 2 - 198
Target Start/End: Complemental strand, 27118714 - 27118515
Alignment:
2 ggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgag 98  Q
    ||||||||||| ||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| |||||||||||||    
27118714 ggtatcggagggaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctgag 27118615  T
99 gttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagc 195  Q
    |||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   | | | || | ||||||||||||||||||    
27118614 gttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatgcgggtacgacggaggtagctgagcagc 27118518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 32049749 - 32049595
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||      
32049749 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatg 32049650  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | ||||||||||| |  ||||| ||||| ||||| |||||||||||||| |||||    
32049649 ggtatggcggaggcatttgagctgcattgatgggagcaacagtagccattgattg 32049595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 34157038 - 34156838
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
34157038 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 34156939  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
34156938 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 34156842  T
195 catt 198  Q
    ||||    
34156841 catt 34156838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 34303517 - 34303717
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||  | | | |||| ||||||||||||    
34303517 tggtatcagaggaaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacgacattaacgggtacctga 34303616  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
34303617 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 34303713  T
195 catt 198  Q
    ||||    
34303714 catt 34303717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 11635482 - 11635633
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
11635482 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 11635581  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| ||||||||||||||    
11635582 atgacggaggcatttgagctgcattgataggagcaacggtagccatggattg 11635633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 11641671 - 11641822
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
11641671 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 11641770  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| ||||||||||||||    
11641771 atgacggaggcatttgagctgcattgataggagcaacggtagccatggattg 11641822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 3784681 - 3784481
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  ||||||| |||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
3784681 tggtatcagaggaaaggtaggtctagcctgttgctactgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 3784582  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
3784581 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 3784485  T
195 catt 198  Q
    ||||    
3784484 catt 3784481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 16163626 - 16163426
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
16163626 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 16163527  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||||||   | |||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
16163526 ggttgacc---cgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 16163430  T
195 catt 198  Q
    ||||    
16163429 catt 16163426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 261058 - 261209
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
261058 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 261157  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||  ||||| || || |||||||||||||| |||||    
261158 atgacggaggcatttgagttgcattgataggagcaacagtagccattgattg 261209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 12586749 - 12586598
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  |||    
12586749 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatggat 12586650  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||  ||||| || || |||||||||| |||||||||    
12586649 atgacggaggcatttgagttgcattgataggagcaacagtagtcatggattg 12586598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 21677475 - 21677626
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||| ||  | |    
21677475 gcaatcgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggt 21677574  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    |||||||||| |  ||||| ||||| || || |||||||||||||| |||||    
21677575 atggcggaggcatttgagctgcattgataggagcaacagtagccattgattg 21677626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 34279400 - 34279246
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| || |||||||| || ||||||||||||||||| ||  |||| ||      
34279400 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatg 34279301  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
34279300 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 34279246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 13936837 - 13936988
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || |||||||| || ||||||||||||||||| ||  |||| ||  | |    
13936837 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggt 13936936  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
13936937 atgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 13936988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 12716943 - 12717049
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
12716943 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 12717042  T
219 tggattg 225  Q
    |||||||    
12717043 tggattg 12717049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 27434734 - 27434888
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |     || ||||| ||||| |||||||| ||||||||||||||||||||  ||   ||      
27434734 tgagcaattgcattaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggtggaaagaaaggatgctgagagtacggcgcatatg 27434833  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | || | |||||| |  || ||||||||||| || ||||||||||||||||||||    
27434834 ggtacgacggaggcatttgggcagcattaataggagcaacagtagccatggattg 27434888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 27803640 - 27803489
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
27803640 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 27803541  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||  ||||| || || |||||||||| ||| |||||    
27803540 atgacggaggcatttgagttgcattgataggagcaacagtagtcattgattg 27803489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 37925441 - 37925290
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
37925441 gcaatcgcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 37925342  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
37925341 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 37925290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 40233447 - 40233296
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||| ||  | |    
40233447 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggt 40233348  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| |||||    
40233347 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattg 40233296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 16829676 - 16829782
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||  ||||| ||||| ||||| |||||||    
16829676 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagttgcattgatgggagcaacggtagcca 16829775  T
219 tggattg 225  Q
    |||||||    
16829776 tggattg 16829782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 16891805 - 16891699
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||  ||||| ||||| ||||| |||||||    
16891805 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagttgcattgatgggagcaacggtagcca 16891706  T
219 tggattg 225  Q
    |||||||    
16891705 tggattg 16891699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 28882165 - 28882011
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
28882165 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 28882066  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || || ||||| || || ||||||||||||||||||||    
28882065 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattg 28882011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 12655493 - 12655408
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
12655493 tgagcgattgcattaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgaga 12655408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 20837869 - 20837784
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
20837869 tgagcgattgcattaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgaga 20837784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 23128856 - 23128941
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
23128856 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 23128941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 27392996 - 27392964
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttg 33  Q
    |||||||||||||||||||||||||||||||||    
27392996 tggtatcggaggaaaggtaggtctggtttgttg 27392964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 19416792 - 19416943
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
19416792 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 19416891  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
19416892 atgacggaggcatttgagccgcattgataggagcaacagtagccattgattg 19416943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 27777155 - 27777004
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||| || |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
27777155 gcaattgcattgacgggcacttgaggttgacctggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 27777056  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||  ||||| || || |||||||||| ||| |||||    
27777055 atgacggaggcatttgagttgcattgataggagcaacagtagtcattgattg 27777004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 27816922 - 27816771
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||| || |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
27816922 gcaattgcattgacgggcacttgaggttgacctggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 27816823  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||  ||||| || || |||||||||| ||| |||||    
27816822 atgacggaggcatttgagttgcattgataggagcaacagtagtcattgattg 27816771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 31876229 - 31876078
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
31876229 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 31876130  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
31876129 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 31876078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 34861628 - 34861477
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
34861628 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 34861529  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
34861528 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 34861477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 37686202 - 37686353
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
37686202 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 37686301  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
37686302 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 37686353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 37701467 - 37701618
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
37701467 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 37701566  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
37701567 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 37701618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 34286305 - 34286151
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||  ||||||||||||||  ||||||||||||| |   | || ||||| || |||||||| || |||||||||||||| || ||  |||| ||      
34286305 tgagcaactgcattgacgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatg 34286206  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || |||||||| |||||||||||    
34286205 ggtatgacggaggcatttgagccgcattgataggagcaacagtggccatggattg 34286151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 34291365 - 34291211
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||  ||||||||||||||  ||||||||||||| |   | || ||||| || |||||||| || |||||||||||||| || ||  |||| ||      
34291365 tgagcaactgcattgacgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatg 34291266  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || |||||||| |||||||||||    
34291265 ggtatgacggaggcatttgagccgcattgataggagcaacagtggccatggattg 34291211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 39889965 - 39889859
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||| ||||    
39889965 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtggcca 39889866  T
219 tggattg 225  Q
    |||||||    
39889865 tggattg 39889859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 159
Target Start/End: Original strand, 39052121 - 39052206
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| || |||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||    
39052121 gcaattgcgttgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagta 39052206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 16208256 - 16208480
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    |||||||||||||||||||||||| | |||||| || || |||||| |  | |||||||| || ||||||||| | |||||||| | ||||||||||||     
16208256 tggtatcggaggaaaggtaggtctagcttgttgatgttgttgttgaactggtggctgttgttgcatttgctgaacgatggcattaatgggtacctgaggc 16208355  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||  | ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| ||||||||||    
16208356 tgacccgatggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgcatgtactgatacggcggaggtaactgggcagcattaa 16208455  T
201 tgggggcaacagtagccatggattg 225  Q
    | |||||||||||||||||||||||    
16208456 taggggcaacagtagccatggattg 16208480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 54 - 225
Target Start/End: Complemental strand, 20461079 - 20460908
Alignment:
54 gctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctg 153  Q
    ||||||| || ||||||||| | |||||||| ||||||||||||||||||||||  | | | ||||| || ||||| |||||||| ||||||||||||||    
20461079 gctgttgttgcatttgctgaacgatggcattaacgggtacctgaggttgacccgatggtagaggatattgatgatagaatggtggaaagaaaggatgctg 20460980  T
154 agagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||||||||||   ||| | || |||||||||| ||| ||||||||||| ||||||| |||||||||||||||    
20460979 agagtattgcgcatacgggtacggcggaggtaactgggcagcattaataggggcaatagtagccatggattg 20460908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 20340560 - 20340760
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | ||| || ||||| |||||   |||  | |||||||| || ||||| ||| | | |||||||||||||||||||    
20340560 tggtatcggaggaaaggtaggtctagcttgctgatgctgttgttgttgagctggaggctgttgttgcatttgttgaacgacggcattgacgggtacctga 20340659  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||  |||| | || | |||||||||||||||||    
20340660 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcgtacgggtacgacggaggtagctgagcag 20340756  T
195 catt 198  Q
    ||||    
20340757 catt 20340760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 225
Target Start/End: Original strand, 41793610 - 41793763
Alignment:
72 gagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactg 171  Q
    ||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||| ||||| ||  |||| ||  |    
41793610 gagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgttgagaatacggcatatatgg 41793709  T
172 atatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
     |||| |||||| |  || || ||||| || || ||||| ||||||||||||||    
41793710 gtatgacggaggcatttgggctgcattgataggagcaacggtagccatggattg 41793763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 28584932 - 28584781
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||| | |    
28584932 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatacgggt 28584833  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
28584832 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 28584781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 10962621 - 10962470
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
10962621 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 10962522  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
10962521 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 10962470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 51638124 - 51638018
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
51638124 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 51638025  T
219 tggattg 225  Q
    | |||||    
51638024 ttgattg 51638018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 89; Significance: 5e-43; HSPs: 28)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 2 - 225
Target Start/End: Complemental strand, 20160728 - 20160502
Alignment:
2 ggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgag 98  Q
    ||||||||||||||||||||||| ||||||||||| || |||||   |||  | |||||||||||| ||||||||||||||||||| |||||||||||||    
20160728 ggtatcggaggaaaggtaggtctagtttgttgctgttgttgttgttgagctggtggctgttgctgtttttgctgagcaatggcattaacgggtacctgag 20160629  T
99 gttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcatt 198  Q
    |||||||||| | | | |||||||| || |||||||||||  |||||||||| |||||||| ||     || | ||||| |||||||  |||| ||||||    
20160628 gttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatggtggaggtaattgagtagcatt 20160529  T
199 aatgggggcaacagtagccatggattg 225  Q
    ||  |||||||||||||||||||||||    
20160528 aacaggggcaacagtagccatggattg 20160502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 2 - 225
Target Start/End: Original strand, 22172103 - 22172329
Alignment:
2 ggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgag 98  Q
    ||||||||||||||||||||||| ||||||||||| || |||||   |||  | |||||||||||| ||||||||||||||||||| |||||||||||||    
22172103 ggtatcggaggaaaggtaggtctagtttgttgctgttgttgttgttgagctggtggctgttgctgtttttgctgagcaatggcattaacgggtacctgag 22172202  T
99 gttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcatt 198  Q
    |||||||||| | | | |||||||| || |||||||||||  |||||||||| |||||||| ||     || | ||||| |||||||  |||| ||||||    
22172203 gttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatggtggaggtaattgagtagcatt 22172302  T
199 aatgggggcaacagtagccatggattg 225  Q
    ||  |||||||||||||||||||||||    
22172303 aacaggggcaacagtagccatggattg 22172329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 28162685 - 28162485
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| | ||||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
28162685 tggtatcagaggaaaggtaggtctagcttgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 28162586  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||| ||||   |||||   |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||| | || |  ||||||||||||||||    
28162585 ggttgtcccg---atggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgatggaggtagctgagcag 28162489  T
195 catt 198  Q
    ||||    
28162488 catt 28162485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 22477441 - 22477671
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc------tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacc 94  Q
    ||||||| |||||||||||||||| | ||||||||| ||       |||||| || | | |||||| || ||||| |||||||| ||||| |||||||||    
22477441 tggtatcagaggaaaggtaggtctagcttgttgctgttgtcgttgttgttgaaccggtgactgttgttgcatttgttgagcaattgcattaacgggtacc 22477540  T
95 tgaggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgag 191  Q
    |||||||||||||   |||||   |||||||  ||||| |||||||| ||||| |||||||||||||| |||   ||| | || | | ||||||  || |    
22477541 tgaggttgacccg---atggcaaaggatactaatgatagaatggtggaaagaagggatgctgagagtactgcgcatacgggtacgacagaggtaattggg 22477637  T
192 cagcattaatgggggcaacagtagccatggattg 225  Q
    |||||||||| |||||||||||||||||||||||    
22477638 cagcattaattggggcaacagtagccatggattg 22477671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 8892478 - 8892678
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
8892478 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 8892577  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||||||   | |||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
8892578 ggttgacc---cgatggcaaagaatactgatgatataatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 8892674  T
195 catt 198  Q
    ||||    
8892675 catt 8892678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 13522241 - 13522441
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
13522241 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 13522340  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
13522341 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 13522437  T
195 catt 198  Q
    ||||    
13522438 catt 13522441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 33374424 - 33374624
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
33374424 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 33374523  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
33374524 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 33374620  T
195 catt 198  Q
    ||||    
33374621 catt 33374624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 26918332 - 26918178
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
26918332 tgagcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 26918233  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
26918232 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 26918178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 8903713 - 8903913
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
8903713 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 8903812  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||||||   | |||||| ||||| |||||||| |||||  |||||||||||||||||   |||   || | |||||||||||||||||    
8903813 ggttgacc---cgatggcaaagaatactgatgatagaatggtggaaagaagagatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 8903909  T
195 catt 198  Q
    ||||    
8903910 catt 8903913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 3696012 - 3695861
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
3696012 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 3695913  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| |||||    
3695912 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattg 3695861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 34463608 - 34463759
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
34463608 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 34463707  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||| ||| |||||    
34463708 atgacggaggcatttgagctgcattgataggagcaacagtagtcattgattg 34463759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 27000025 - 26999871
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
27000025 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 26999926  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || || ||||| || || ||||||||||||||||||||    
26999925 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattg 26999871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 30558308 - 30558414
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| ||||| |||||||    
30558308 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 30558407  T
219 tggattg 225  Q
    |||||||    
30558408 tggattg 30558414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 225
Target Start/End: Complemental strand, 4525280 - 4525087
Alignment:
32 tgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaa 131  Q
    ||||||||||||||| |  |||| || || ||||  || ||||| ||||||||||| || ||||||||||| || || |     |||||||| |||||||    
4525280 tgctgctgctgttgaactggcggttgatgttgtacctgttgagcgatggcattgacaggaacctgaggttggcctggtggcaaaggatactgatgataaa 4525181  T
132 atggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
4525180 acggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagccatagattg 4525087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 16674076 - 16673925
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||| ||  |||    
16674076 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatggat 16673977  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| ||||| || |||||    
16673976 atgacggaggcatttgagctgcattgataggagcaacggtagctattgattg 16673925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 26988953 - 26988799
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
26988953 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 26988854  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || || ||||| || || ||||||||||||||||||||    
26988853 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattg 26988799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 13299195 - 13299280
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
13299195 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 13299280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 15424561 - 15424646
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
15424561 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 15424646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 16749806 - 16749721
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
16749806 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgaga 16749721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 108
Target Start/End: Original strand, 22935121 - 22935158
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccgg 108  Q
    |||||||| |||||||||||||||||||||||||||||    
22935121 tgagcaattgcattgacgggtacctgaggttgacccgg 22935158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 108
Target Start/End: Original strand, 23857566 - 23857603
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccgg 108  Q
    |||||||| |||||||||||||||||||||||||||||    
23857566 tgagcaattgcattgacgggtacctgaggttgacccgg 23857603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 29549430 - 29549342
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
29549430 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 29549342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 16944274 - 16944425
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
16944274 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 16944373  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
16944374 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 16944425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 29572962 - 29572811
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
29572962 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 29572863  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
29572862 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 29572811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 24304862 - 24305016
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||| ||||||||||| ||  |||  ||      
24304862 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatg 24304961  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || |||||||| || || || |||||||||||||||||    
24304962 ggtatgacggaggcatttgggcagcattgataggagcgacagtagccatggattg 24305016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 26777919 - 26778025
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |||| |||||| |  || || | ||| || || |||||||||||||    
26777919 tactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggcatttgggctgtattgataggtgcaacagtagcca 26778018  T
219 tggattg 225  Q
    | |||||    
26778019 ttgattg 26778025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 27007616 - 27007510
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
27007616 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatataggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 27007517  T
219 tggattg 225  Q
    | |||||    
27007516 ttgattg 27007510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 24863669 - 24863584
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    |||||||| ||||| |||||||| || ||||||| ||| | | | || ||||| ||||| ||||| || |||||||||||||||||    
24863669 tgagcaattgcattaacgggtacttggggttgactcggtggtagagggtactgatgatagaatggcggaaagaaaggatgctgaga 24863584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 42)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 16626772 - 16626999
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | |||||||||||| |||||   |||  | |||||||| || ||||||||| | |||||||| ||||||||| ||    
16626772 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgttgttgagctggtggctgttgttgcatttgctgaacgatggcattaacgggtaccgga 16626871  T
98 ggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcat 197  Q
    ||||||||||  | | | |||||||| ||||| || ||||| ||||| |||||||||||||||||    ||| | || | |||||||| ||| |||||||    
16626872 ggttgacccgatggtagaggatactgatgatagaacggtggaaagaagggatgctgagagtattgtgcatacgggtacgacggaggtaactgggcagcat 16626971  T
198 taatgggggcaacagtagccatggattg 225  Q
    |||| |||||||||||||||||||||||    
16626972 taataggggcaacagtagccatggattg 16626999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 18530380 - 18530159
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggt 100  Q
    |||||||||||||||||||||||| | ||||||||||||   ||||||  | |||||||| || ||||||||| | | |||||| ||||| || ||||||    
18530380 tggtatcggaggaaaggtaggtctagcttgttgctgctg---ttgagctggtggctgttgttgcatttgctgaacgacggcattaacgggcacttgaggt 18530284  T
101 tgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaa 200  Q
    |||||||  | | | |||||||| ||||| |||||||| ||||||||||||||||||||||||   ||| | || |  ||||||| ||| ||||||||||    
18530283 tgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgatggaggtaactgggcagcattaa 18530184  T
201 tgggggcaacagtagccatggattg 225  Q
    | |||| ||||||||||||||||||    
18530183 taggggtaacagtagccatggattg 18530159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 7996478 - 7996324
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||      
7996478 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatg 7996379  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | ||||||||||| |  ||||| ||||| ||||| |||||||||||||| |||||    
7996378 ggtatggcggaggcatttgagctgcattgatgggagcaacagtagccattgattg 7996324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 10642986 - 10642832
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||      
10642986 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatg 10642887  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | ||||||||||| |  ||||| ||||| ||||| |||||||||||||| |||||    
10642886 ggtatggcggaggcatttgagctgcattgatgggagcaacagtagccattgattg 10642832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 17994050 - 17994250
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
17994050 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 17994149  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
17994150 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 17994246  T
195 catt 198  Q
    ||||    
17994247 catt 17994250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 28116302 - 28116453
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
28116302 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 28116401  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| ||||||||||||||    
28116402 atgacggaggcatttgagctgcattgataggagcaacggtagccatggattg 28116453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 47023366 - 47023215
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| ||||||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
47023366 gcaattgcattgacgggcacctgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 47023267  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||  ||||| || || |||||||||||||| |||||    
47023266 atgacggaggcatttgagttgcattgataggagcaacagtagccattgattg 47023215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 4625936 - 4625736
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | | |||| ||||||||||||    
4625936 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacgacattaacgggtacctga 4625837  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
4625836 ggttgacccg---atggcaaaggatactgatgatataatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 4625740  T
195 catt 198  Q
    ||||    
4625739 catt 4625736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 11110706 - 11110857
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
11110706 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 11110805  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||  ||||| || || ||||| ||||||||||||||    
11110806 atgacggaggcatttgagttgcattgataggagcaacggtagccatggattg 11110857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 51781924 - 51781773
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||||||  | |    
51781924 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 51781825  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| |||||    
51781824 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattg 51781773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 51797013 - 51796862
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||||||  | |    
51797013 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 51796914  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| |||||    
51796913 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattg 51796862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 4721547 - 4721393
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| |||||||||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||| |||||||||| ||  |||  ||      
4721547 tgagcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaagatgctgagaatacggcacatatg 4721448  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
4721447 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 4721393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 7073128 - 7072974
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| || |||||||| || ||||||||||||||||| ||  |||| ||      
7073128 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatg 7073029  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
7073028 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 7072974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 5652379 - 5652179
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
5652379 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 5652280  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||   |||| ||    ||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
5652279 ggttgacc---cgattgcaaacgatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 5652183  T
195 catt 198  Q
    ||||    
5652182 catt 5652179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 20577207 - 20577358
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||||||||||||||| ||  |||||||  | |    
20577207 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 20577306  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||  ||||| || || |||||||||||||| |||||    
20577307 atgacggaggcatttgagttgcattgataggagcaacagtagccattgattg 20577358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 29665330 - 29665481
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||  |||||||  | |    
29665330 gcaattgcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 29665429  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| |||||    
29665430 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattg 29665481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 36997434 - 36997585
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| ||||||||||| || || |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
36997434 gcaattgcattgacgggcacctgaggttggccgggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 36997533  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| |||||    
36997534 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattg 36997585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 4796995 - 4797149
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
4796995 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 4797094  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || || ||||| || || ||||||||||||||||||||    
4797095 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattg 4797149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 80 - 198
Target Start/End: Complemental strand, 5713134 - 5713016
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcg 179  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | ||    
5713134 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5713035  T
180 gaggtagctgagcagcatt 198  Q
    |||||||||||||||||||    
5713034 gaggtagctgagcagcatt 5713016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 80 - 198
Target Start/End: Complemental strand, 5724044 - 5723926
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcg 179  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | ||    
5724044 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5723945  T
180 gaggtagctgagcagcatt 198  Q
    |||||||||||||||||||    
5723944 gaggtagctgagcagcatt 5723926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 80 - 198
Target Start/End: Original strand, 5757433 - 5757551
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcg 179  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | ||    
5757433 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5757532  T
180 gaggtagctgagcagcatt 198  Q
    |||||||||||||||||||    
5757533 gaggtagctgagcagcatt 5757551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 80 - 198
Target Start/End: Original strand, 5768324 - 5768442
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcg 179  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | ||    
5768324 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacg 5768423  T
180 gaggtagctgagcagcatt 198  Q
    |||||||||||||||||||    
5768424 gaggtagctgagcagcatt 5768442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 6192232 - 6192078
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| |||||||||||||| |||||||||||||| |   | || ||||  ||||||||||| |  ||||||||||||||||| ||  |||  ||      
6192232 tgagcaattgcattgacgggtacttgaggttgacccggtggcagagggtactaatgataaaatggcgaaaagaaaggatgctgagaatacggcacatatg 6192133  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
6192132 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 6192078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 17985346 - 17985452
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| ||||| |||||||    
17985346 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 17985445  T
219 tggattg 225  Q
    |||||||    
17985446 tggattg 17985452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 35880682 - 35880528
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
35880682 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 35880583  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
35880582 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 35880528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 225
Target Start/End: Complemental strand, 8211696 - 8211503
Alignment:
32 tgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaa 131  Q
    ||||||||||||||| |  |||| || || ||||  || ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||    
8211696 tgctgctgctgttgaactggcggttgatgttgtacctgttgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaa 8211597  T
132 atggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | ||||||||||| ||||||||||||||  ||   ||  | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
8211596 acggtgggaagaacggatgctgagagtacggcgcatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 8211503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 74 - 159
Target Start/End: Complemental strand, 48465828 - 48465743
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || |||||||||||||| |  || || ||||| || ||||| ||||||||||| ||||||||||||||    
48465828 gcaattgcattgacgggcacttgaggttgacccggtggcggggggtactgatggtaaaacggtgggaagaacggatgctgagagta 48465743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 5013625 - 5013474
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
5013625 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 5013526  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| ||||| |||||||||||||| |||||    
5013525 atgacggaggcatttgagctgcattgatgggagcaacagtagccattgattg 5013474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 18225104 - 18224953
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |    
18225104 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggt 18225005  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
18225004 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 18224953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 5466853 - 5466747
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||||||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
5466853 tactgatgataaaatggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 5466754  T
219 tggattg 225  Q
    | |||||    
5466753 tagattg 5466747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 15741424 - 15741578
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
15741424 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 15741523  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || || ||||| || || ||||||||||||||||||||    
15741524 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattg 15741578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 22871264 - 22871370
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| | |||||| ||||| || || |||||||||||||    
22871264 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22871363  T
219 tggattg 225  Q
    | |||||    
22871364 tagattg 22871370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 22886323 - 22886429
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| | |||||| ||||| || || |||||||||||||    
22886323 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22886422  T
219 tggattg 225  Q
    | |||||    
22886423 tagattg 22886429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 8295891 - 8295806
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| || ||||| |||||||||||||| ||  | || ||||| ||||||||||| || |||||||||||||||||    
8295891 tgagcgattgcattaacaggtacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgaga 8295806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 4893129 - 4893041
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
4893129 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 4893041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 18277394 - 18277482
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
18277394 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 18277482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 18292695 - 18292783
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
18292695 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 18292783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Original strand, 18307996 - 18308084
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
18307996 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 18308084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 32439073 - 32438985
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
32439073 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 32438985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 24328072 - 24327921
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
24328072 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 24327973  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
24327972 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 24327921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 6542864 - 6542970
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
6542864 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 6542963  T
219 tggattg 225  Q
    | |||||    
6542964 ttgattg 6542970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Original strand, 29149145 - 29149182
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| |||||||| |||||||||||||||||||||||    
29149145 tactgatgataaaacggtgggaagaaaggatgctgaga 29149182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 23)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 16450109 - 16450336
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctg---ctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | ||||||||||||   |||||||||  | |||||||| || | ||||||| | | |||||| | ||||||||||    
16450109 tggtatcggaggaaaggtaggtctagcttgttgctgctgttgctgttgagctggtggctgttgttgcacttgctgaacgacggcattaatgggtacctga 16450208  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| |||||||||||||| ||||| |||||||||||||| |||  |||| | || | |||||||| ||| ||||    
16450209 ggttgacccg---atggcaaaggatactgatgataaaatggtggaaagaagggatgctgagagtactgcgcgtacgggtacgacggaggtaactgggcag 16450305  T
195 cattaatgggggcaacagtagccatggattg 225  Q
    ||||||| |||||||||||||| ||||||||    
16450306 cattaataggggcaacagtagctatggattg 16450336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 16041355 - 16041128
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||| ||||||||||| | |||||| ||||| |||||   | |  | |||||||| || ||||||||| | | || ||| ||||||||||||    
16041355 tggtatcggagggaaggtaggtctagcttgttgatgctgttgttgttgaactggtggctgttgttgcatttgctgaacgacggaattaacgggtacctga 16041256  T
98 ggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcat 197  Q
    ||||||||||  ||    |||||||| ||||| |||||||| ||||| ||||||||||||||| ||   ||  | || | |||||||| ||| |||||||    
16041255 ggttgacccgatgacaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggcgcatatgggtacgacggaggtaactgggcagcat 16041156  T
198 taatgggggcaacagtagccatggattg 225  Q
    |||| |||||||||||||||||||||||    
16041155 taataggggcaacagtagccatggattg 16041128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 31088575 - 31088775
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
31088575 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 31088674  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
31088675 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 31088771  T
195 catt 198  Q
    ||||    
31088772 catt 31088775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 45733492 - 45733292
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
45733492 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 45733393  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
45733392 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 45733296  T
195 catt 198  Q
    ||||    
45733295 catt 45733292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 3445247 - 3445096
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||||||||||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  |||||||  | |    
3445247 gcaattgcattgacgggcacttgaggttgacccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtatgggt 3445148  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
3445147 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 3445096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 5147530 - 5147681
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| |||||||| ||||||||||| ||||||||||||||  |||| ||  |||    
5147530 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatggat 5147629  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||  ||||||||||||||    
5147630 atgacggaggcatttgagctgcattgataggagcaatggtagccatggattg 5147681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 5127948 - 5127794
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | |||||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
5127948 tgagcaattgcattaacgggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 5127849  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
5127848 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 5127794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 16503567 - 16503721
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| ||||||||||||||||||||||| |     |||||||| ||||| ||||| || ||||||||||||||||||||  ||   ||      
16503567 tgagcaattgcattaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatg 16503666  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || ||||||||||| || ||||||||||||||||||||    
16503667 ggtatgacggaggcatttgggcagcattaataggagcaacagtagccatggattg 16503721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 16518603 - 16518757
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| ||||||||||||||||||||||| |     |||||||| ||||| ||||| || ||||||||||||||||||||  ||   ||      
16518603 tgagcaattgcattaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatg 16518702  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || ||||||||||| || ||||||||||||||||||||    
16518703 ggtatgacggaggcatttgggcagcattaataggagcaacagtagccatggattg 16518757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 11441513 - 11441362
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
11441513 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 11441414  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| |||||    
11441413 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattg 11441362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 45387296 - 45387145
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |    
45387296 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggt 45387197  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
45387196 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 45387145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 74 - 159
Target Start/End: Complemental strand, 26435210 - 26435125
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| |||||||| ||||||||||| ||||||||||||||    
26435210 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagta 26435125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 225
Target Start/End: Complemental strand, 2154559 - 2154375
Alignment:
41 tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtggga 140  Q
    |||||| |||||  |||||| | ||| || |||||||| ||||| |||| ||| |||||||||||||| |   | || ||||| ||||||||||| || |    
2154559 tgttgaaccagcaactgttgttttatctgttgagcaattgcattaacggatacttgaggttgacccggtggcagagggtactgatgataaaatggcggaa 2154460  T
141 agaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    |||||||||||||||| ||  |||  ||  | |||| |||||| |  || || ||||| || || ||||||||||||||||||||    
2154459 agaaaggatgctgagaatacggcacatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattg 2154375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 4145310 - 4145464
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||      
4145310 tgagcgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatg 4145409  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
4145410 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 4145464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 74 - 159
Target Start/End: Original strand, 26485934 - 26486019
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||    
26485934 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagta 26486019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 74 - 159
Target Start/End: Original strand, 26538063 - 26538148
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| ||||||||||| ||||||||||||||    
26538063 gcaattgcattgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagta 26538148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 5159478 - 5159390
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||    
5159478 tgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagta 5159390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 9618604 - 9618453
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
9618604 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 9618505  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
9618504 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 9618453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 24592731 - 24592882
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
24592731 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 24592830  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
24592831 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 24592882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 26275284 - 26275435
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
26275284 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 26275383  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
26275384 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 26275435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 26320059 - 26320210
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
26320059 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 26320158  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
26320159 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 26320210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 11424963 - 11425117
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| || |||||||| || ||||||||||||||||| ||  |||| ||      
11424963 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatg 11425062  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || ||  |||| || || ||||||||||||||||||||    
11425063 ggtatgacggaggcatttgggctacattgataggagcaacagtagccatggattg 11425117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 10917052 - 10917137
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| || ||||| |||||||||||||| |   | |||||||| ||||||||||| || ||||| |||||||||||    
10917052 tgagcgattgcattaacaggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaagggatgctgaga 10917137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 2883 - 3083
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||||||||||||||| | ||| || ||||| |||||   |||  | |||||||| || ||||| ||| | | |||||||||||||||||||    
2883 tggtatcggaggaaaggtaggtctagcttgctgatgctgttgttgttgagctggaggctgttgttgcatttgttgaacgacggcattgacgggtacctga 2982  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||  |||| | || | |||||||||||||||||    
2983 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcgtacgggtacgacggaggtagctgagcag 3079  T
195 catt 198  Q
    ||||    
3080 catt 3083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 41)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 22888510 - 22888287
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    |||||||||||| ||||||||||| | |||||| ||||| |||||   | |  | |||||||| || ||||||||| | | |||||| |||| |||||||    
22888510 tggtatcggagggaaggtaggtctagcttgttgatgctgttgttgttgaactggtggctgttgttgcatttgctgaacgacggcattaacggttacctga 22888411  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||| ||   ||  | || | |||||||| ||| ||||    
22888410 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggcgcatatgggtacgacggaggtaactgggcag 22888314  T
195 cattaatgggggcaacagtagccatgg 221  Q
    ||||||| |||||||||||||||||||    
22888313 cattaataggggcaacagtagccatgg 22888287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 23892246 - 23892016
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg------agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacc 94  Q
    |||||||||||||||||||||||| | |||||| || || |||||      | || | |||||||| || ||||||||| | ||||||||||||||||||    
23892246 tggtatcggaggaaaggtaggtctagcttgttgatgttgttgttgttgttgaaccggtggctgttgttgcatttgctgaacgatggcattgacgggtacc 23892147  T
95 tgaggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgag 191  Q
    |||||||||||||   |||||   |||||||| ||||| |||| ||| ||||||||||||||||||||  ||   ||  | || | |||||| |  || |    
23892146 tgaggttgacccg---atggcaaaggatactgatgatagaatgttggaaagaaaggatgctgagagtacggcgcatatgggtacgacggaggcatttggg 23892050  T
192 cagcattaatgggggcaacagtagccatggattg 225  Q
    |||||||||| || ||||||||||||||||||||    
23892049 cagcattaataggagcaacagtagccatggattg 23892016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 13184770 - 13184970
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
13184770 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 13184869  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
13184870 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 13184966  T
195 catt 198  Q
    ||||    
13184967 catt 13184970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 13440616 - 13440816
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
13440616 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 13440715  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
13440716 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 13440812  T
195 catt 198  Q
    ||||    
13440813 catt 13440816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 33877287 - 33877087
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||  | | |||||| ||||||||||||    
33877287 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctggacgacggcattaacgggtacctga 33877188  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
33877187 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 33877091  T
195 catt 198  Q
    ||||    
33877090 catt 33877087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 8665676 - 8665827
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| ||  | || ||||| ||||||||||| || ||||||||||||||||| ||  |||| ||  | |    
8665676 gcaatcgcattgacgggcacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggt 8665775  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    |||||||||| |  ||||| ||||| || || |||||||||||||| |||||    
8665776 atggcggaggcatttgagctgcattgataggagcaacagtagccattgattg 8665827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 2 - 156
Target Start/End: Complemental strand, 24970057 - 24969903
Alignment:
2 ggtatcggaggaaaggtaggtctggtttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggtt 101  Q
    ||||||||||| || |||||||| | |||||| || || |||||| || || ||||||| |  || || |||||||| ||||| ||||||||||||||||    
24970057 ggtatcggagggaaagtaggtctagcttgttgatgttgttgttgaaccggcagctgttgtttcatctgttgagcaattgcattaacgggtacctgaggtt 24969958  T
102 gacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||||| |     |||||||| ||||| ||||| || |||||||||||||||||    
24969957 gacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgaga 24969903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 11325834 - 11325634
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgc---tgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||| |||||||||||||||| |  |||||||||||    ||||||||  | |||||||| || ||| ||||| | | |||||| ||||||||||||    
11325834 tggtatcagaggaaaggtaggtctagcctgttgctgctgtcgttgttgagctggaggctgttgttgcattcgctgaacgacggcattaacgggtacctga 11325735  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcag 194  Q
    ||||| |||    |||||   |||||||| ||||| |||||||| ||||| ||||||||||||||||||   |||   || | |||||||||||||||||    
11325734 ggttgtccca---atggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggtagctgagcag 11325638  T
195 catt 198  Q
    ||||    
11325637 catt 11325634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 18500949 - 18501100
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
18500949 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 18501048  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||  ||||| || || |||||||||||||| |||||    
18501049 atgacggaggcatttgagttgcattgataggagcaacagtagccattgattg 18501100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 30168430 - 30168279
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |     || ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |    
30168430 gcaattgcattgacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggt 30168331  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| ||||| |||| |||||||||||||||    
30168330 atgacggaggcatttgagctgcattgatgggagcaatagtagccatggattg 30168279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 25199069 - 25198908
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctgctgttg---agccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctga 97  Q
    ||||||||||| |||||||||||| | |||||| ||||| |||||   | |  | |||||||| || ||||||||| | | ||| || ||| ||||||||    
25199069 tggtatcggagaaaaggtaggtctagcttgttgatgctgttgttgttgaactggtggctgttgttgcatttgctgaacgacggcgttaacgagtacctga 25198970  T
98 ggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||||||||   |||||   |||||||| ||||| |||||||| ||||||||||||||||||||    
25198969 ggttgacccg---atggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagta 25198908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 74 - 219
Target Start/End: Complemental strand, 43078210 - 43078065
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || |||||||||||||| |   | || ||||| |||||||| ||||||||||||||||||||||| ||  |||||||  | |    
43078210 gcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggt 43078111  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccat 219  Q
    | | |||||| |  ||||| ||||| || || ||||||||||||||    
43078110 acgacggaggcatttgagctgcattgataggtgcaacagtagccat 43078065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 74 - 218
Target Start/End: Complemental strand, 31431389 - 31431245
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| |||||||||||||| |||||||||||||| |   | || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
31431389 gcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 31431290  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||    
31431289 atgacggaggcatttgagctgcattgataggagcaacagtagcca 31431245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 18375658 - 18375764
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| |||||||||||||    
18375658 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 18375757  T
219 tggattg 225  Q
    | |||||    
18375758 ttgattg 18375764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 22999312 - 22999466
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| ||||||||||||||||   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
22999312 tgagcgattgcattaacgggtacttgaggttgacccggcggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 22999411  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || || ||||| || || ||||||||||||||||||||    
22999412 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattg 22999466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 24681353 - 24681247
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
24681353 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24681254  T
219 tggattg 225  Q
    |||||||    
24681253 tggattg 24681247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 24723880 - 24723774
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| ||||||||||| |||||||||||||||||||| ||  |||| ||  | |||| |||||| |  ||||| ||||| || || |||||||||||||    
24723880 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24723781  T
219 tggattg 225  Q
    |||||||    
24723780 tggattg 24723774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 33516272 - 33516166
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| ||||| |||||||    
33516272 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagccgcattgatgggagcaacggtagcca 33516173  T
219 tggattg 225  Q
    |||||||    
33516172 tggattg 33516166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 71 - 225
Target Start/End: Complemental strand, 33777451 - 33777297
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
33777451 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 33777352  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
33777351 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 33777297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 9548741 - 9548826
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    |||||||| |||||||||||||| |||||||||||||| |   | || ||||| || |||||||| || |||||||||||||||||    
9548741 tgagcaattgcattgacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgaga 9548826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 30151979 - 30151828
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
30151979 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 30151880  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| ||||| |||||||||||||| |||||    
30151879 atgacggaggcatttgagctgcattgatgggagcaacagtagccattgattg 30151828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 159
Target Start/End: Complemental strand, 33292535 - 33292404
Alignment:
28 ttgttgctgctgctgttgagccagcggctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtga 127  Q
    ||||||||||||||||||| |  |||| || || || |  || ||||| ||||||||||| || ||||||||||| ||||| |     || ||||| |||    
33292535 ttgttgctgctgctgttgaactggcggttgatgttgcacctgttgagcgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatga 33292436  T
128 taaaatggtgggaagaaaggatgctgagagta 159  Q
    ||||| ||||||||||| ||||||||||||||    
33292435 taaaacggtgggaagaacggatgctgagagta 33292404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 37754929 - 37754778
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  |||    
37754929 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggat 37754830  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
37754829 atgacggaggcatttgagctgcattgataggtgcaacagtagccattgattg 37754778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 40473753 - 40473904
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| || |||||||| || ||||| || |||||||   | || ||||| || ||||| ||||||||||| ||||||||||||||  ||||||   | |    
40473753 gcaattgcgttgacgggcacttgaggctggcccggcggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatgtgtgggt 40473852  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || ||||||||||||||||| |||||    
40473853 atgacggaggcatttgagctgcattgataggggcaacagtagccattgattg 40473904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 153
Target Start/End: Complemental strand, 11549318 - 11549236
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctg 153  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| |||||||||||||| ||||||||||||||    
11549318 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggtggaaagaaaggatgctg 11549236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 23718186 - 23718340
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
23718186 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 23718285  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || || ||||| || || ||||||||||||||||||||    
23718286 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattg 23718340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 23752648 - 23752802
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
23752648 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 23752747  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  || || ||||| || || ||||||||||||||||||||    
23752748 ggtatgacggaggcatttgggctgcattgataggagcaacagtagccatggattg 23752802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 3789487 - 3789336
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| |||||||| || ||||| |     || ||||| |||||||| ||||||||||| ||||||||||||||  |||| ||  | |    
3789487 gcaattgcattgacgggcacctgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggt 3789388  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || ||||| |||||||| |||||    
3789387 atgacggaggcatttgagctgcattgataggagcaacggtagccattgattg 3789336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 5637871 - 5637720
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
5637871 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 5637772  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
5637771 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 5637720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 9317412 - 9317261
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
9317412 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 9317313  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
9317312 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 9317261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 12132116 - 12131965
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
12132116 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 12132017  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
12132016 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 12131965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 15759058 - 15759209
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
15759058 gcaatcgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 15759157  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
15759158 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 15759209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 26480353 - 26480202
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
26480353 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 26480254  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
26480253 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 26480202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 29967267 - 29967418
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
29967267 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 29967366  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
29967367 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 29967418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Complemental strand, 30029376 - 30029225
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
30029376 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 30029277  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
30029276 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 30029225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 31826620 - 31826771
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
31826620 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 31826719  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
31826720 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 31826771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 37771200 - 37771351
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  |||    
37771200 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggat 37771299  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | | |||||| |  ||||| ||||| || || |||||||||||||| |||||    
37771300 acgacggaggcatttgagctgcattgataggtgcaacagtagccattgattg 37771351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 15658958 - 15659112
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||||||||| || |||||||||||||| |   | || ||||| || ||||| || || ||||||||||||||||| ||  |||  ||      
15658958 tgagcaattgcattgacgggcacttgaggttgacccggtggcagagggtactgatggtaaaacggcggaaagaaaggatgctgagaatacggcacatatg 15659057  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    |||||| |||||| |  ||||  ||||| || || |||||||||||||| |||||    
15659058 gatatgacggaggcatttgagttgcattgataggagcaacagtagccattgattg 15659112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Complemental strand, 28649142 - 28649105
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| ||||||||||| ||||||||||||||||||||    
28649142 tactgatgataaaatggcgggaagaaaggatgctgaga 28649105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 30934600 - 30934515
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||| |||||||||||    
30934600 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgaga 30934515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 155
Target Start/End: Complemental strand, 41674670 - 41674589
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgag 155  Q
    ||||| |||||||||||||| |||||| ||||||| |   | || ||||| || |||||||| || ||||||||||||||||    
41674670 gcaattgcattgacgggtacttgaggtggacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgag 41674589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: scaffold0124
Description:

Target: scaffold0124; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 54 - 225
Target Start/End: Complemental strand, 20384 - 20213
Alignment:
54 gctgttgctgtatttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggc---ggatactggtgataaaatggtgggaagaaaggatg 150  Q
    ||||||| || ||||||||| | | |||||| ||||||||||||||||||||||   |||||   |||||||| ||||| |||| ||| ||||| |||||    
20384 gctgttgttgcatttgctgaacgacggcattaacgggtacctgaggttgacccg---atggcaaaggatactgatgatagaatgatggaaagaagggatg 20288  T
151 ctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    |||||||||| ||   ||  | || | |||||||| ||| ||||||||||| |||||||||||||||||||||||    
20287 ctgagagtatggcgcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattg 20213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 30408 - 30323
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||| |||||||||||    
30408 tgagcgattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgaga 30323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 71 - 225
Target Start/End: Original strand, 431 - 585
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    |||||||| ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || ||||||||||||||||| ||  |||  ||      
431 tgagcaattgcattaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatg 530  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    | |||| |||||| |  ||||| ||||| || || ||||||||||||||||||||    
531 ggtatgacggaggcatttgagctgcattgataggagcaacagtagccatggattg 585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 119 - 225
Target Start/End: Original strand, 15279 - 15385
Alignment:
119 tactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    ||||| |||||||| ||||||||||| ||||||||||| ||| |||| ||  | |||| |||||| |  ||||| ||||| ||||| |||||||||||||    
15279 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 15378  T
219 tggattg 225  Q
    | |||||    
15379 ttgattg 15385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 27247 - 27162
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| | | | || ||||| ||||||||||| || |||||||||||||||||    
27247 tgagcgattgcattaacgggtacttgaggttgacccggtggtagagggtactgatgataaaatggcggaaagaaaggatgctgaga 27162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0496 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0496
Description:

Target: scaffold0496; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 37 - 188
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  |||    
37 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatggat 136  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
137 atgacggaggcatttgagctgcattgataggtgcaacagtagccattgattg 188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 26506 - 26657
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||    ||| ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
26506 gcaattgcattgacgggcacttgaggctggcccggcggcaacgggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 26605  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
26606 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 26657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Original strand, 47286 - 47371
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgaga 156  Q
    ||||| || ||||| |||||||| |||||||||||||| |   | || ||||| ||||||||||| || |||||||||||||||||    
47286 tgagcgattgcattaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgaga 47371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 108
Target Start/End: Original strand, 40370 - 40407
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccgg 108  Q
    |||||||| ||||| |||||||||||||||||||||||    
40370 tgagcaattgcatttacgggtacctgaggttgacccgg 40407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 219
Target Start/End: Complemental strand, 5936 - 5796
Alignment:
80 gcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaat-ggtgggaagaaaggatgctgagagtattgcatgtactgatatggc 178  Q
    ||||||||||| || |||||||||||||| |   | || ||||| ||||||||  ||||||||||||||||||||||| ||  |||||||  | |||| |    
5936 gcattgacgggcacttgaggttgacccggtggcagagggtactgatgataaaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgac 5837  T
179 ggaggtagctgagcagcattaatgggggcaacagtagccat 219  Q
    ||||| |  ||||  ||||| || || ||||||||||||||    
5836 ggaggcatttgagttgcattgataggagcaacagtagccat 5796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0350
Description:

Target: scaffold0350; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 225
Target Start/End: Original strand, 7543 - 7694
Alignment:
74 gcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgat 173  Q
    ||||| ||||||||||| || ||||| || |||||||     || ||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||  | |    
7543 gcaattgcattgacgggcacttgaggctggcccggcggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggt 7642  T
174 atggcggaggtagctgagcagcattaatgggggcaacagtagccatggattg 225  Q
    ||| |||||| |  ||||| ||||| || || |||||||||||||| |||||    
7643 atgacggaggcatttgagctgcattgataggagcaacagtagccattgattg 7694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 218
Target Start/End: Complemental strand, 8187 - 8040
Alignment:
71 tgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtact 170  Q
    ||||| ||||||||||| || ||||||||||| || || |     |||||||| |||||||| ||||||||||| ||||||||||| ||  |||| ||      
8187 tgagcgatggcattgacaggaacctgaggttggcctggtggcaaaggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatg 8088  T
171 gatatggcggaggtagctgagcagcattaatgggggcaacagtagcca 218  Q
    | |||| |||||| |  ||||| ||||| || || |||||||||||||    
8087 ggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 8040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0558 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0558
Description:

Target: scaffold0558; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 253 - 291
Alignment:
1 tggtatcggaggaaaggtaggtctggtttgttgctgctg 39  Q
    |||||||||||||||||||||||| | ||||||||||||    
253 tggtatcggaggaaaggtaggtctagcttgttgctgctg 291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University