View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6911_low_45 (Length: 220)
Name: NF6911_low_45
Description: NF6911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6911_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 6555081 - 6555287
Alignment:
| Q |
1 |
taggtttttatatttagtcaatctcatccttacaaaaccggtactaatactggtgatcatgtacaaaatcgatacttatcttatctcttaagattagttt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6555081 |
taggtttttatatttagtcaaactcatccttacaaaaccagtactaatactggtgatcaagtacaaaatcgatacttatcttatctcttaagattagttt |
6555180 |
T |
 |
| Q |
101 |
cctccatattacttagttactaacatgannnnnnncactgtttttaagaaaaatactatatactatctactaagattaaggaagccatggattggccact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6555181 |
cctccatattacttagttactaacatgatttttttcactgtttttaagaaaaatactatatactatctactaagattaaggaagccatggattggccact |
6555280 |
T |
 |
| Q |
201 |
aactttg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
6555281 |
aactttg |
6555287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University