View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6912_high_3 (Length: 254)

Name: NF6912_high_3
Description: NF6912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6912_high_3
NF6912_high_3
[»] chr3 (1 HSPs)
chr3 (160-236)||(41347986-41348062)


Alignment Details
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 160 - 236
Target Start/End: Complemental strand, 41348062 - 41347986
Alignment:
160 aatagggcacacagaaattaaatactcaatgagatataataatttttgttataaaagtactagtataatgttacagt 236  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
41348062 aatagagcacacagaaattaaatactcaatgagatataataatttttgttatagaagtactagtataatgttacagt 41347986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University