View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6912_low_4 (Length: 328)
Name: NF6912_low_4
Description: NF6912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6912_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 18 - 153
Target Start/End: Original strand, 2503122 - 2503257
Alignment:
| Q |
18 |
atcacttctccaatgtccctatatattaaagccagtatagtgtgccaatcagcatatacacacctaacctcactacttcactctttatcattgctaaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2503122 |
atcacttctccaatgtccctatatattaaagccattatagtgtgccaatcagcatatacacacctaacctcactacttcactctttatcattgctaaaat |
2503221 |
T |
 |
| Q |
118 |
tctctcaaaagcaaaatgagaactgaaagtattata |
153 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2503222 |
tctctcaaaagcaaaatgagaactaaaagtattata |
2503257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 183 - 308
Target Start/End: Original strand, 2503287 - 2503412
Alignment:
| Q |
183 |
caatccttcaaatgcaaaacaaacaaagcccttttcaactatactcaatattaaccatgttctagacaaaatttctcagctaaaaaatgttacacaagga |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2503287 |
caatccttcaaatgcaaaacaaacaaagcccttttcaactatactcaatattaaccatgttctagacaaaatttctcagctaaaaaatgttacacaagga |
2503386 |
T |
 |
| Q |
283 |
ttccatgaatcacagttgcaaatctc |
308 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2503387 |
ttccatgaatcacagttgcaaatctc |
2503412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University