View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6913_low_13 (Length: 321)
Name: NF6913_low_13
Description: NF6913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6913_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 27362419 - 27362374
Alignment:
| Q |
89 |
tgattagatggacgaaaatgacttaaacatccatttttgttgacaa |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27362419 |
tgattagatggacgaaaatgacttaaacatccatttttgatgacaa |
27362374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 156
Target Start/End: Original strand, 53870768 - 53870805
Alignment:
| Q |
119 |
ccatttttgttgacaacctttgaaacaacttaaatata |
156 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
53870768 |
ccatttttgttgacaacttttggaacaacttaaatata |
53870805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University