View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6913_low_8 (Length: 469)
Name: NF6913_low_8
Description: NF6913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6913_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 4e-85; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 226 - 393
Target Start/End: Complemental strand, 32324463 - 32324296
Alignment:
| Q |
226 |
acactccaactatataatattggttattgctttaatttatagtcctttgaattgcacaaaaggtcattgattttatcagatcgtaactctcgatccacaa |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32324463 |
acactccaactatataatattggttattgctttaatttatagtccttcgaattgcacaaaaggtcattgattttatcagatcgtaactctcgatccacaa |
32324364 |
T |
|
| Q |
326 |
aaatattggaagtacgacccaaatcattgctttttggatcagaacgtaactctcgataagcttctttc |
393 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32324363 |
aaatattggaagtgcgacccaaatcattgctttttggatcagaacgtaactctcgataagcttctttc |
32324296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 159; E-Value: 2e-84
Query Start/End: Original strand, 19 - 181
Target Start/End: Complemental strand, 32324670 - 32324508
Alignment:
| Q |
19 |
agatatgctagtggtggtgtgatgaagattccaatgggaaggtggattatctgttcatgccatcatcttcttcttattctcatttgtatatagctttttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32324670 |
agatatgctagtggtggtgtgatgaagattccaatgggaaggtggattatctgttcatgccatcatcttcttcttattctcatttgtatatagctttctt |
32324571 |
T |
|
| Q |
119 |
ctcaagctagctattccttcttttttggtttgttgtatgatacagttttgggccaagtggacc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32324570 |
ctcaagctagctattccttcttttttggtttgttgtatgatacagttttgggccaagtggacc |
32324508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 392 - 457
Target Start/End: Complemental strand, 32324239 - 32324174
Alignment:
| Q |
392 |
tcaaaggttgaacaatcggatgggtctatatatttctttctcttttaggcaccttgtgatgtccat |
457 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32324239 |
tcaaaggttgaacaatcagatgggtctatatatttctttctcttttaggcaccttgtgatgcccat |
32324174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University