View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_high_19 (Length: 298)
Name: NF6914_high_19
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_high_19 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 291
Target Start/End: Original strand, 441830 - 442106
Alignment:
| Q |
15 |
gtgacaacaaactgcctcttcaccattgctcttcaggtatgaacatcgactgtcagtttagcgctcgagtttgatcaatttgtgatatggcagccgcgtt |
114 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||| | ||| ||||||| ||||||||||||| | || |||||||||||||| |||||||||||||||||| |
|
|
| T |
441830 |
gtgaaaacaagctgcctcttcaccattgctctttaagtacgaacatcaactgtcagtttagtggtcaagtttgatcaatttttgatatggcagccgcgtt |
441929 |
T |
 |
| Q |
115 |
gatgccactggcgttgcaatggtggagtcccgataatcccttacttttgaactcattgtcgtaatggacacgtttatatctacacatggcctcatcgtgc |
214 |
Q |
| |
|
||||||||||||||||||| ||| || ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
441930 |
gatgccactggcgttgcaaaggttgaatcctgataatcccatacttttgaactcattgtcgtaatggacacgtttatatctacacatggcctcattgtgc |
442029 |
T |
 |
| Q |
215 |
ccatggtcttgtgtggcggacaatcagattgttccgttgaagcctccacaataatcacaattgttttcacaggttct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
442030 |
ccatggtcttgtgtggcggacaatcagattgttccgttgaagcctccacaataatcacaattgttttcacagattct |
442106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University