View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_high_31 (Length: 244)
Name: NF6914_high_31
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 48232045 - 48231823
Alignment:
| Q |
14 |
aatataaccatcaagatagtatgaaaaagtttgtattttcaatgtctgcatactgacatatatcaagaatgacccatttaagataaggttactgtaatac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48232045 |
aatataaccatcaagatagtatgaaaaagtttgtattttcaatgtctgcatactgacatatatcaagaatgacccatttaagataaggttactgtaatac |
48231946 |
T |
 |
| Q |
114 |
ttgtgacatgggtcaaaggcaaaaagttagataatgcaggacactcactttcactttataattttgtctgtcccttggttttttagtttgagaatttact |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48231945 |
ttgtgacatgggtcaaaggcaaaaagttagataatgcaggacactcactttcactttataattttgtctgtcccttggttttttagtttgagaatttgct |
48231846 |
T |
 |
| Q |
214 |
ataaggctccgatgatgtccatc |
236 |
Q |
| |
|
||||||||||||| |||| |||| |
|
|
| T |
48231845 |
ataaggctccgataatgtacatc |
48231823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University