View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6914_high_36 (Length: 233)

Name: NF6914_high_36
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6914_high_36
NF6914_high_36
[»] chr1 (1 HSPs)
chr1 (1-231)||(21078367-21078597)
[»] chr6 (1 HSPs)
chr6 (153-209)||(3073724-3073780)
[»] chr4 (1 HSPs)
chr4 (153-209)||(27732088-27732144)


Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 21078367 - 21078597
Alignment:
1 ccacatccttcttccctgtctccttcttggagcaacagagtgatatgtgtgatcttgatcagtttcaagtggatgatgcaccaccagttattaacttatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21078367 ccacatccttcttccctgtctccttcttggagcaacagagtgatatgtgtgatcttgatcagtttcaagtggatgatgcaccaccagttattaacttatc 21078466  T
101 caaatattttcctccaagttcccataaaaagaaaaagcgcagcatcgtgagaagaaatatgattgatcatgaacttcttaatgcagcacatatactcttg 200  Q
    ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21078467 caaatatttgcctccaagttcccataaaaagaaaaaacgcagcatcgtgagaagaaatatgattgatcatgaacttcttaatgcagcacatatactcttg 21078566  T
201 gatatgtctcgtggtggtggtggtgatgatg 231  Q
    |||||||||||||||||||||||||||||||    
21078567 gatatgtctcgtggtggtggtggtgatgatg 21078597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 3073780 - 3073724
Alignment:
153 agaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtct 209  Q
    |||||||| ||||||||||||| |||||||| |||| ||| |||||| |||||||||    
3073780 agaaatatcattgatcatgaacatcttaatggagcatatacactcttcgatatgtct 3073724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 209
Target Start/End: Complemental strand, 27732144 - 27732088
Alignment:
153 agaaatatgattgatcatgaacttcttaatgcagcacatatactcttggatatgtct 209  Q
    |||||||| ||||||||||||| |||||||| |||||| | ||||||  ||||||||    
27732144 agaaatatcattgatcatgaacatcttaatggagcacaaacactcttcaatatgtct 27732088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University