View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_high_40 (Length: 224)
Name: NF6914_high_40
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 49009077 - 49009266
Alignment:
| Q |
17 |
catcatccatggtagaa-tgattcccggtagcgaaggtgtacttgtaaatacttttacgttcaagtatat--gatcgagatatgtataggtttagaataa |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||| || ||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
49009077 |
catcatccatggtagaaatgattcccggtagcgaaggtgtacttataaatactttgacattcaagtatatatgatcgagatatgtataggtttggaataa |
49009176 |
T |
 |
| Q |
114 |
ggcattgcttgatatgtgattagtgcaaggctttatatagttcaaagaagatgatatcacgcttgggtcaactggaaagttcactctataac |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49009177 |
ggcattgcttgatatgtgatg-gtgcaaggctt-atatagtttaaagaagatgatatcacgcttgggtcaactggaaagctcactctataac |
49009266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University