View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_low_12 (Length: 439)
Name: NF6914_low_12
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 33487626 - 33487392
Alignment:
| Q |
18 |
cagagcactgaaagaatattaagaattgaggaccaatgataataatattgggaattgctatgattgaattagatttattttggcaaccactctgtgtgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33487626 |
cagagcactgaaagaatattaagaattgaggaccaatgataataatattgggaattgctatgattgaattagatttattttggcaaccactctgtgtgtg |
33487527 |
T |
 |
| Q |
118 |
ttgatactttgattgggttatcatttccacaaatgcaaggttgcagcaacaatccattaaaagttttcaactat-ttttcaatttttagagctcaatgga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
33487526 |
ttgatactttgattgggttatcatttccacaaatgcaaggttgcagcaacaatccattcaaagttttcaactatttttttaatttttagagctcaatgga |
33487427 |
T |
 |
| Q |
217 |
gttgaaatccaagtcactgctaaattgttttctac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33487426 |
gttgaaatccaagtcactgctaaattgttttctac |
33487392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 294 - 414
Target Start/End: Complemental strand, 33487354 - 33487242
Alignment:
| Q |
294 |
ggagtaaatagaaatttggtgaaaatgacaccggttaatcgttcaaatatagtaataatattttataaattgtatagtcaattcttcaaaagtttaagaa |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33487354 |
ggagtaaatagaaatttggtgaaaatgacatcggttaataattcaaatatagtaataatattttataaattgtatagtcaattc--------tttaagaa |
33487263 |
T |
 |
| Q |
394 |
gtgttctttacatagtgttgt |
414 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
33487262 |
gtgttctttatatagtgttgt |
33487242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University