View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6914_low_33 (Length: 298)

Name: NF6914_low_33
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6914_low_33
NF6914_low_33
[»] scaffold0002 (1 HSPs)
scaffold0002 (15-291)||(441830-442106)


Alignment Details
Target: scaffold0002 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 291
Target Start/End: Original strand, 441830 - 442106
Alignment:
Q  15 gtgacaacaaactgcctcttcaccattgctcttcaggtatgaacatcgactgtcagtttagcgctcgagtttgatcaatttgtgatatggcagccgcgtt 114  Q
    |||| ||||| |||||||||||||||||||||| | ||| ||||||| ||||||||||||| | || |||||||||||||| ||||||||||||||||||    
T  441830 gtgaaaacaagctgcctcttcaccattgctctttaagtacgaacatcaactgtcagtttagtggtcaagtttgatcaatttttgatatggcagccgcgtt 441929  T
Q  115 gatgccactggcgttgcaatggtggagtcccgataatcccttacttttgaactcattgtcgtaatggacacgtttatatctacacatggcctcatcgtgc 214  Q
    ||||||||||||||||||| ||| || ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  441930 gatgccactggcgttgcaaaggttgaatcctgataatcccatacttttgaactcattgtcgtaatggacacgtttatatctacacatggcctcattgtgc 442029  T
Q  215 ccatggtcttgtgtggcggacaatcagattgttccgttgaagcctccacaataatcacaattgttttcacaggttct 291  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  442030 ccatggtcttgtgtggcggacaatcagattgttccgttgaagcctccacaataatcacaattgttttcacagattct 442106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University