View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_low_45 (Length: 257)
Name: NF6914_low_45
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 49584674 - 49584898
Alignment:
| Q |
18 |
gggagaaagttccggaggctttcgcatttggatatctagacaaaaagaagcgcaacagaagtcaggaggactgtttagtatcaaaaccttcacgacatgt |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584674 |
gggagaaagttccggaggcttttgcatttggatatctagacaaaaagaagcgcaacagaagtcaggaggactgtttagtatcaaaaccttcacgacatgt |
49584773 |
T |
 |
| Q |
118 |
gtgtcgtaaagtggaaggttctggtagtggtggtgttgcaggttctgaaaatgaggaaggagcaaaggttgtctccaacggccggtaatggcattgctag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49584774 |
gtgtcgtaaagtggaaggttctggtagtggtggtgttgcaggttctgaaaatgaggaaggagcaaaggttgtctccaa----cggtaatggcattgctag |
49584869 |
T |
 |
| Q |
218 |
cagtaacggaggcttcaaacaatgatgtc |
246 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
49584870 |
cagtaacgaaggcttcaaacaatgatgtc |
49584898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University