View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_low_55 (Length: 244)
Name: NF6914_low_55
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 20193945 - 20194178
Alignment:
| Q |
1 |
caatcggatataggcttgctgttgattgttagggtgattcggaccttgaagatgaggatggggattgctaagatgagactgttgttgggcatgtacgggg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20193945 |
caatcggatataggcttgttgttgattgttagggtgattcggaccttgaagatgaggatggggattgctaagatgagactgttgttgggcatgtacgggg |
20194044 |
T |
|
| Q |
101 |
tattgctgaaccgatgggggagttgtttgactattaaaagcagaactcatcccactaaaggcaggaatgccttggctgttcccttgggtgacctgcattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20194045 |
tattgctgaaccgatgggggagttgtttgactattaaaagcagaactcatcccactaaaggcaggaatgccttggctgttcccttgggtgacctgcattg |
20194144 |
T |
|
| Q |
201 |
gaagttccggaaccatcatttgcctttgatgtcc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20194145 |
gaagttccggaaccatcatttgcctttgatgtcc |
20194178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University