View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_low_58 (Length: 241)
Name: NF6914_low_58
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 10 - 166
Target Start/End: Original strand, 20193730 - 20193886
Alignment:
| Q |
10 |
gacatcagagtcaaaggagatgatggtgttgcaggggaaacagatacttgctgagatgaattttgtggttgcgcctgggaactattttgctgaggtgatg |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20193730 |
gacatcggagtcaaaggagatgatggtgttgcaggggaaacagatacttgctgagatgaattttgtggttgcgcctgggaactattttgctgaggtgatg |
20193829 |
T |
|
| Q |
110 |
atatgggaggttgggcttgtgcctgaacatgtggaatcaaagcatttgtcgcagaaa |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20193830 |
atatgggaggttgggcttgtgcctgaacatgtggaatcaaagcatttgtcgcagaaa |
20193886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 208 - 241
Target Start/End: Original strand, 20193928 - 20193961
Alignment:
| Q |
208 |
agttgcctttcctttgccaatcggatataggctt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20193928 |
agttgcctttcctttgccaatcggatataggctt |
20193961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University