View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_low_62 (Length: 233)
Name: NF6914_low_62
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 49 - 219
Target Start/End: Complemental strand, 38995801 - 38995631
Alignment:
| Q |
49 |
gtgcaatcatcttgatgaagtttactaaaaatagttgttaatttgagaaaaggtcgacaaaaagataattggatctcacagaacgatgtgtggatgatgg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38995801 |
gtgcaatcatcttgatgaagtttactaaaaatagttgttaatttgagaaaaggtcgacaaaaagataattggatctcacagaacgatgtgtggatgatgg |
38995702 |
T |
|
| Q |
149 |
ggattcttctttttctttatgttttagctccatannnnnnnnaggtttcatcttaaaactttgatgtccat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
38995701 |
ggattcttctttttctttatgttttagctccatattttttttaggtttcatcttaaaactttgatttccat |
38995631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University