View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_low_65 (Length: 227)
Name: NF6914_low_65
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_low_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 16 - 156
Target Start/End: Original strand, 49004735 - 49004875
Alignment:
| Q |
16 |
atgtatactcttaataaaagaaattaacatatttcttgagagaaaaaatgacgaagaaaaaacaaatggtagacgattatcagaatgtaccggcgttcaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||| || |
|
|
| T |
49004735 |
atgtatactcttaataaaagaaattaacatatttcttgagagagaaaatgacgaagaaaaaacaaatgatagacgattatcagaatgcaccggcgttaaa |
49004834 |
T |
 |
| Q |
116 |
attccttcgtctggtgagaactcaagtttatcaaaggatat |
156 |
Q |
| |
|
||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
49004835 |
attccttgttctggtgagaatttaagtttatcaaaggatat |
49004875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 156 - 220
Target Start/End: Original strand, 49009029 - 49009093
Alignment:
| Q |
156 |
taaatgacgaatttaagtaagaaacgctccttcaatgatgttggtggccatcatccatggtagaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49009029 |
taaatgacgaatttaagtaagaaacgctccttcaatgatgttggtggccatcatccatggtagaa |
49009093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University