View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_low_69 (Length: 217)
Name: NF6914_low_69
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 12 - 200
Target Start/End: Complemental strand, 28977395 - 28977207
Alignment:
| Q |
12 |
agaatatgagaggttaacttactggctcacaagcatcaggaaacatcttcttaagctgtaacatcacgaaatttgctgctgactcatcagataacttctc |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28977395 |
agaacatgagaggttaacttactggctcacaagcatcaggaaacatcttcttaagctgtaacatcacaaaatttgctgctgactcatcagataacttctc |
28977296 |
T |
 |
| Q |
112 |
aaggtcataagcaaacctaccagctgccatataaacaagaacaggattgcctgttgctttatggagattgagaaaatagccacatgcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28977295 |
aaggtcataagcaaacctaccagctgccatataaacaagaacaggattgcctgttgctttatggagattgagaaaatagccacatgcat |
28977207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University