View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6914_low_73 (Length: 201)
Name: NF6914_low_73
Description: NF6914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6914_low_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 46726020 - 46725833
Alignment:
| Q |
1 |
agaaaatggcaattaacgttgcttactgtgactctggacttagccaaccttcatatttgtctttaaaatccaaaatgtgatattgccacaaatggttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46726020 |
agaaaatggcaattaacgttgcttactgtgactcaggacttagccaaccttcatatttgtctttaaaatccaaaatgtgatattgccacaaatggttgaa |
46725921 |
T |
|
| Q |
101 |
tatctgcaagtgcacggttaattatgttgatatttcaataagaaaatattagtaagggaaatgctaatcataaacccctactgatgtc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46725920 |
tatctgcaagtgcacggttaattatgttgatatttcaataagaaaatattagtaagggaaatgctaatcataaacccctactgatgtc |
46725833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 22 - 62
Target Start/End: Complemental strand, 7920901 - 7920861
Alignment:
| Q |
22 |
cttactgtgactctggacttagccaaccttcatatttgtct |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
7920901 |
cttactgtgactctggacttagccaaccttcgtatctgtct |
7920861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University