View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6915_high_2 (Length: 368)
Name: NF6915_high_2
Description: NF6915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6915_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 43591712 - 43592060
Alignment:
| Q |
1 |
aaattggttttttaaccttcacgggattggagtatattgtcggtttacaatgttgtaaatgtatatccttttttcacttttgtatcacttggagttggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43591712 |
aaattggttttttaaccttcacggaattgcagtatattgtcggtttacaatgttgtaaatgtatatccttttttcacttttgtatcacttggagttggaa |
43591811 |
T |
 |
| Q |
101 |
tttttaactttctcctagcaatggtaaaggataggatcatttgctggcatagaaaatttagtcatagaaatgattataaccactaannnnnnnattattt |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43591812 |
tttttaactttctcctagcaatggtgaaggataggatcatttgctggcatagaaattttagtcatagaaatgattataaccactaa---atttattattt |
43591908 |
T |
 |
| Q |
201 |
ccacattgcatgcatgcaaaaatggtaggggatgatgactcaagactatgtatttactttgataaacacaaggtaaatatactggtttgattactttctt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43591909 |
ccacattgcatgcatgcaaaaatggtaggggatgatgactcaagactatgtctttattttgataaacacaaggtaaatatcatggtttgattactttctt |
43592008 |
T |
 |
| Q |
301 |
ttgaggcttagttaatctaatttatgatttattttattttatttggaatgtg |
352 |
Q |
| |
|
| || ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43592009 |
tcgacgcttagttaatctaatttaggatttattttattttatttggaatgtg |
43592060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 194 - 324
Target Start/End: Original strand, 40798538 - 40798668
Alignment:
| Q |
194 |
attatttccacattgcatgcatgcaaaaatggtaggggatgatgactcaagactatgtatttactttgataaacacaaggtaaatatactggtttgatta |
293 |
Q |
| |
|
|||||||| ||||||| ||| ||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40798538 |
attatttcagcattgcaggcacacaaaagtggtaggcgatgatgactcaagactatgtctttactttgataaacacaaggtaaatatactggtttgatta |
40798637 |
T |
 |
| Q |
294 |
ctttcttttgaggcttagttaatctaattta |
324 |
Q |
| |
|
|||||||| |||||| |||||||||||||| |
|
|
| T |
40798638 |
ctttctttcaaggcttggttaatctaattta |
40798668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University