View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6915_low_1 (Length: 406)
Name: NF6915_low_1
Description: NF6915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6915_low_1 |
 |  |
|
| [»] scaffold0082 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0082 (Bit Score: 398; Significance: 0; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 1 - 402
Target Start/End: Original strand, 51855 - 52256
Alignment:
| Q |
1 |
ttcgtgttccagaatgggcagctaaagccttttatttgcctttcatgacgatgaatgaatagtcttctccctctgatcatgatcatggcttgcttaccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51855 |
ttcgtgttccagaatgggcagctaaagccttttatttgcctttcatgacgatgaatgaatagtcttctccctctgatcatgatcatggcttgcttaccgg |
51954 |
T |
 |
| Q |
101 |
gacttcacttttcccttggttggatggaagtagcctcgtctcgtggcgccggtatcgaccatcgcacgagcagagtggccatttcattcagcactatctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51955 |
gacttcacttttcccttggttggatggaagtagcctcgtctcgtggcgccggtatcgaccatcgcacgagcagagtggccatttcattcagcactatctc |
52054 |
T |
 |
| Q |
201 |
aacatacataagcccagcagacgtaggcttctaatgggtgatcgcattccgcaactgtaacggattcaccctaggggttcttccctcttgtcctcggcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52055 |
aacatacataagcccagcagacgtaggcttctaatgggtgatcgcattccgcaactgtaacggattcaccctaggggttcttccctcttgtcctcggcaa |
52154 |
T |
 |
| Q |
301 |
ccagcaagtttctccttcatcggacaatctcgtgcctgaggaggactcttacaaatgaaagagccagagtccgccttagaaggccttctttgatgtccat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52155 |
ccagcaagtttctccttcatcggacaatctcgtgcctgaggaggactcttacaaatgaaagagccagagtccgccttagaaggccttctttgctgtccat |
52254 |
T |
 |
| Q |
401 |
ct |
402 |
Q |
| |
|
|| |
|
|
| T |
52255 |
ct |
52256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University