View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6915_low_3 (Length: 261)
Name: NF6915_low_3
Description: NF6915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6915_low_3 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 57 - 261
Target Start/End: Original strand, 31401915 - 31402117
Alignment:
| Q |
57 |
gatgcttgaggagggagctatatctttggcgcaatatatcgggtgttttctcagatttggaagagtgtggctccgtccaaaattgtagctttctcttgag |
156 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| | |||| |||||||||||||||||| |
|
|
| T |
31401915 |
gatgcttgaggaaggagctatatctttggcgcaatgc--cgggtgttttctcagatttggaagagggtggctccatacaaagttgtagctttctcttgag |
31402012 |
T |
|
| Q |
157 |
gggaattgttagaagtctcacattggataaaaatatgagccttgagcaatatatacattataggaccataaatccaatgtgttagggtttcgagtcacta |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31402013 |
gggaattgttagaagtctcacattggataaaaatatgagccttgagcaatatatacactataggaccataaatccaatgtgttagggtttcgagtcacta |
31402112 |
T |
|
| Q |
257 |
tatga |
261 |
Q |
| |
|
||||| |
|
|
| T |
31402113 |
tatga |
31402117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 164 - 222
Target Start/End: Original strand, 31380021 - 31380079
Alignment:
| Q |
164 |
gttagaagtctcacattggataaaaatatgagccttgagcaatatatacattataggac |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||| || ||||||| |
|
|
| T |
31380021 |
gttagaagtcttacattggataaaaatatgagccttgagtaatatataaatgataggac |
31380079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University