View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6916_high_5 (Length: 314)
Name: NF6916_high_5
Description: NF6916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6916_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 21 - 164
Target Start/End: Original strand, 36365500 - 36365642
Alignment:
| Q |
21 |
atattgttcgccactaatttctaccaaggcaagtagtagcaaacatatttagtgttatccttgtgatgatctacgtgaataaattcgactgaacttatga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36365500 |
atattgttcgccactaatttctaccaaggcaagtagtagcaa-catatttagtgttatccttgtgatgatctacgtgaataaattcgactgaacttgtga |
36365598 |
T |
 |
| Q |
121 |
taaaagttttgcctgaatccaatttgggttggtttaacttcttt |
164 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
36365599 |
taaaagttttgcctaaattcaatttgggttggtttaatttcttt |
36365642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University