View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6916_low_10 (Length: 243)

Name: NF6916_low_10
Description: NF6916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6916_low_10
NF6916_low_10
[»] chr8 (2 HSPs)
chr8 (18-151)||(7611174-7611307)
chr8 (204-232)||(7611093-7611121)


Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 7611307 - 7611174
Alignment:
18 gttagaaataagtgggggagcagtacaaataataaattgcaactgtttaaccacttggagtataactcttacaaccattgtgagtaaaatcagaatgact 117  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7611307 gttagaaataagtgggggagcagtacaaataataaattacaactgtttaaccacttggagtataactcttacaaccattgtgagtaaaatcagaatgact 7611208  T
118 ttgtttgaagtcaatgattgaaatttgaataaaa 151  Q
    ||||||||||||||||||||| ||||||||||||    
7611207 ttgtttgaagtcaatgattgatatttgaataaaa 7611174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 204 - 232
Target Start/End: Complemental strand, 7611121 - 7611093
Alignment:
204 aagaaagaaatataacatgcatataagta 232  Q
    |||||||||||||||||||||||||||||    
7611121 aagaaagaaatataacatgcatataagta 7611093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University