View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6916_low_10 (Length: 243)
Name: NF6916_low_10
Description: NF6916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6916_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 7611307 - 7611174
Alignment:
| Q |
18 |
gttagaaataagtgggggagcagtacaaataataaattgcaactgtttaaccacttggagtataactcttacaaccattgtgagtaaaatcagaatgact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7611307 |
gttagaaataagtgggggagcagtacaaataataaattacaactgtttaaccacttggagtataactcttacaaccattgtgagtaaaatcagaatgact |
7611208 |
T |
|
| Q |
118 |
ttgtttgaagtcaatgattgaaatttgaataaaa |
151 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
7611207 |
ttgtttgaagtcaatgattgatatttgaataaaa |
7611174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 204 - 232
Target Start/End: Complemental strand, 7611121 - 7611093
Alignment:
| Q |
204 |
aagaaagaaatataacatgcatataagta |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7611121 |
aagaaagaaatataacatgcatataagta |
7611093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University