View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6917_high_16 (Length: 319)
Name: NF6917_high_16
Description: NF6917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6917_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 303
Target Start/End: Complemental strand, 38799203 - 38798915
Alignment:
| Q |
18 |
cttaaagcctgtaacatccattcttcatgcatatggacgaatattaattcacacttcgtgccccataattagatacattgtggcacgaatatcaaagaaa |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38799203 |
cttaaagcctataacatccattcttcatgcatatggacgaatattaattcacacttcgtgccccataattagatacattgtggcacgaatatcaaagaaa |
38799104 |
T |
 |
| Q |
118 |
ctagatagaaatgatgaacataattactactatactactatattattatgaggataaattg---atgggatggatgcataaggtgatttaattatggtac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38799103 |
ctagatagaaatgatgaacataattactactatactactatattattatgaggataaattgatcatgggatggatgcataaggtgatttaattatggtac |
38799004 |
T |
 |
| Q |
215 |
ataacccttgtaaattcaagcagcaagaacaccaagaggaatgggaaaactggaggcaaaatccacgatccttcgtcaatctattttca |
303 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38799003 |
ataacccttgtaaattcaagcagcaggaacaccaagaggaatgggaaaactggaggcaaaatccacgatccttcgtcaatctattttca |
38798915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University