View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6917_high_19 (Length: 253)
Name: NF6917_high_19
Description: NF6917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6917_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 31036848 - 31036698
Alignment:
| Q |
15 |
cgcatttgatgagtcctggtcccaaattattttgagatgctactattgctccaacatgatgatacaaaatatctgactaagtggccaagatgaacaagca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||| ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
31036848 |
cgcatttgatgagtcctggtcccaaattgttt-gagatgctactattgctccaacgtgagaatacaaaatttctgactaagtggctaagatgaacaagca |
31036750 |
T |
 |
| Q |
115 |
actttcactattatcttgtggaagaatttataagaagtaactttgtaatttt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31036749 |
actttcactattatcttgtggaagaatttataagaagtaactttgtaatttt |
31036698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 152 - 237
Target Start/End: Complemental strand, 31036681 - 31036597
Alignment:
| Q |
152 |
taactttgtaattttataatgagcggttatgccaagcataaagctggtatattgtatgttaaatgaatgccttcaattttgcaaat |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||| || |||||| |||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
31036681 |
taactttgtaattttataatgaacggttatgtcaagtatcaagctgttatattgtatgttaaatgaatgccgtc-attttgcaaat |
31036597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University