View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6917_high_21 (Length: 241)

Name: NF6917_high_21
Description: NF6917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6917_high_21
NF6917_high_21
[»] chr3 (2 HSPs)
chr3 (139-225)||(8431974-8432060)
chr3 (6-50)||(8431318-8431362)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 139 - 225
Target Start/End: Original strand, 8431974 - 8432060
Alignment:
139 aatttccatgttagaaagtagctgtgtttacaagttaatgcaacatagatcaagtcatgtaatatttagctaggcaagcttaattta 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
8431974 aatttccatgttagaaagtagctgtgtttacaagttaatgcaacatatatcaattcatgtaatatttagctaggcaagcttaattta 8432060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 6 - 50
Target Start/End: Original strand, 8431318 - 8431362
Alignment:
6 gagatggacatcatacatcgattaaggtaaatatgcatgcaactt 50  Q
    ||||| |||||||||||||||||||||||||||||||||||||||    
8431318 gagattgacatcatacatcgattaaggtaaatatgcatgcaactt 8431362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University