View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6917_low_19 (Length: 326)
Name: NF6917_low_19
Description: NF6917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6917_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 7744486 - 7744335
Alignment:
| Q |
13 |
acctgtgccactttatagacttggtgtagtcattgcagccgcaggatataaattcaaagacaaagtttcctaacatggcaaaatatatagtcgtcctttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7744486 |
acctgtgccactttatagacttggtgtagtcattgcagccgcaggatataaattcaaagacaaagtttcctaacatggcaaaatatatagtcgtcctttt |
7744387 |
T |
 |
| Q |
113 |
cctgcatacctgctgagatcc-ttttctccatatgaatgcgacgtcttatgc |
163 |
Q |
| |
|
||| ||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
7744386 |
ccttcatacctgctgagatcctttttctccagatgaatgcgacgtcttatgc |
7744335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 222 - 280
Target Start/End: Complemental strand, 7744274 - 7744216
Alignment:
| Q |
222 |
gccaaaaccttaaactttttgttgttgacttggcttcacacacaaacacagtcctacgt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7744274 |
gccaaaaccttaaactttttgttgttgacttggcttcacacacaaacacagtcctacgt |
7744216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University