View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6917_low_27 (Length: 257)
Name: NF6917_low_27
Description: NF6917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6917_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 235
Target Start/End: Original strand, 39109067 - 39109295
Alignment:
| Q |
7 |
gagcagaacctgtgcaagatcaaatgcgatgttgtcattgttggttccggtagcggcggaggagttgcagctgcaattcttgcaaactcaggtcataaag |
106 |
Q |
| |
|
||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39109067 |
gagcaaaacgtgtacaagatcaaatgcgatgttgtcattgttggttccggtagcggcggaggagttgcagctgcaattcttgcaaactcaggtcataaag |
39109166 |
T |
|
| Q |
107 |
tgatcatcctagaaaaaggagagtattttgtttctcaagattattcttccttggaaagttcagcgatgaacgaactctatgaatcaggtggaatcatgcc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39109167 |
tgatcatcctagaaaaaggagagtattttgtttctcaagattattcttccttggaaagttcagcgatgaacgagctctatgaatcaggtggaatcatgcc |
39109266 |
T |
|
| Q |
207 |
aactcttgacggtaaaatgatgatcttag |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39109267 |
aactcttgacggtaaaatgatgatcttag |
39109295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 91
Target Start/End: Complemental strand, 33522542 - 33522479
Alignment:
| Q |
28 |
aaatgcgatgttgtcattgttggttccggtagcggcggaggagttgcagctgcaattcttgcaa |
91 |
Q |
| |
|
||||| ||||| || ||||| ||||||||| |||| ||||||||||||||||| ||||||||| |
|
|
| T |
33522542 |
aaatgtgatgtggtaattgtcggttccggttgcggtggaggagttgcagctgctgttcttgcaa |
33522479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University