View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6917_low_29 (Length: 244)
Name: NF6917_low_29
Description: NF6917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6917_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 124 - 237
Target Start/End: Complemental strand, 29258019 - 29257906
Alignment:
| Q |
124 |
aaaatcactgaccatggcttctagatgagcagcaaaattagaattgagattgagggtgcttgctaaaggctgacaaccccaatcatcattccaaaagtta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29258019 |
aaaatcactgaccatggcttctagatgagcagcaaaattagaattgagattgagggtgcttgctaaaggctgacaaccccaatcatcattccaaaactta |
29257920 |
T |
|
| Q |
224 |
acctgatgtccatc |
237 |
Q |
| |
|
|||| ||| ||||| |
|
|
| T |
29257919 |
accttatgaccatc |
29257906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University