View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6917_low_31 (Length: 231)

Name: NF6917_low_31
Description: NF6917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6917_low_31
NF6917_low_31
[»] chr1 (3 HSPs)
chr1 (88-165)||(33131788-33131865)
chr1 (91-143)||(33125147-33125197)
chr1 (184-215)||(33131773-33131804)


Alignment Details
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 88 - 165
Target Start/End: Complemental strand, 33131865 - 33131788
Alignment:
88 cacatgtcacttaaatgtcgggtaaaaacaaacacagcattaaattcttcctccacaactgacgcactatcttaatga 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
33131865 cacatgtcacttaaatgtcgggtaaaaacaaacacagcattaaattcttcctccactactgacgcactatcttaatga 33131788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 91 - 143
Target Start/End: Complemental strand, 33125197 - 33125147
Alignment:
91 atgtcacttaaatgtcgggtaaaaacaaacacagcattaaattcttcctccac 143  Q
    ||||||||||||||||||| ||||||  ||||| |||||||||||||||||||    
33125197 atgtcacttaaatgtcgggaaaaaac--acacaacattaaattcttcctccac 33125147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 215
Target Start/End: Complemental strand, 33131804 - 33131773
Alignment:
184 acgcactatcttaatgatgtgctcccacaggt 215  Q
    ||||||||||||||||||||||||||||||||    
33131804 acgcactatcttaatgatgtgctcccacaggt 33131773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University