View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6918_low_16 (Length: 222)
Name: NF6918_low_16
Description: NF6918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6918_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 210
Target Start/End: Complemental strand, 14392686 - 14392497
Alignment:
| Q |
21 |
tgagatactatcatttttcaattgaaaaatcttcgacaaagtatagtattataattattgatattcatgataaatatgatacaagtgtcaactaatctag |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14392686 |
tgagatactatcatttttcaattgaaaaatcttcgacaaagcatagtattataattattattattcatgataaatatgatacaagtgtcaactaatctag |
14392587 |
T |
 |
| Q |
121 |
ttcacaaagttactgcaacacaatggaagaatctttttcagagcaatgacaaataccttcctacaacaatatactattaagtattatcta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14392586 |
ttcacaaagttactgcaacacaatggaagaatatttttcagagcaatgacaaataccttcctacaacaatatactattaagtaatatcta |
14392497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University