View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6920_low_4 (Length: 391)
Name: NF6920_low_4
Description: NF6920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6920_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 378
Target Start/End: Complemental strand, 8002798 - 8002454
Alignment:
| Q |
18 |
catcacctactcttgaattcaatatttgtataagtaaaggaatcacttgtaaaattttgttatgtagtaagtaatatgatgaagtataagtaattattga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
8002798 |
catcacctactcttgaattcaatatttgtataagtaaagcaatcacttgtaaaattttgttatgaagtat----------------taagtaattattga |
8002715 |
T |
 |
| Q |
118 |
attattaacnnnnnnnngttgaattgtatagcaaatatcaatatctttgtttatgcttattgaccacttggaggagaaaactaccttgaatctcattgat |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8002714 |
attattaacaaaaaaaagttgaattgtatagcaaatatcaatatctttgtttatgcttattgaccacttggaggagaaaactacgttgaatctcattgat |
8002615 |
T |
 |
| Q |
218 |
atgtggggattgactttgtaggagtggcagttgggtgcggatggcaagccattgtggcttatataaacgtaggctgttattatggggttggagtctctgt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | || |
|
|
| T |
8002614 |
atgtggggattgactttgtaggagtggcagttgggtgcggatggcaagccattgtggcttatataaacgtaggatgttattatggggttggagtcccagt |
8002515 |
T |
 |
| Q |
318 |
gggttgtgttttaggcttcaaattcaacctgggtgttaaggtatgatactagtagtgattc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8002514 |
gggttgtgttttaggcttcaaattcaaccttggtgttaaggtatgatactagtagtgattc |
8002454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University