View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6920_low_6 (Length: 350)
Name: NF6920_low_6
Description: NF6920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6920_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 17 - 330
Target Start/End: Complemental strand, 6485713 - 6485400
Alignment:
| Q |
17 |
gtggtaaagcaacaaaacatgtaatggttaaacaacttttaaaacaagaatgtgcagtaactgctttagcaattgacagcacaggttcaatggtttattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485713 |
gtggtaaagcaacaaaacatgtaatggttaaacaacttttaaaacaagaatgtgcagtaactgctttagcaattgacagcacaggttcaatggtttattg |
6485614 |
T |
 |
| Q |
117 |
tggtgcttctgatggattggttaacttttgggaacgtgataaacaatttgaacatggtggggtcctcaagggtcataagcttgcagttttgtgtttagct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485613 |
tggtgcttctgatggattggttaacttttgggaacgtgataagcaatttgaacatggtggagtcctcaagggtcataagcttgcagttttgtgtttagct |
6485514 |
T |
 |
| Q |
217 |
tctgctgcgaatttggtttttagtggttcagctgataaaactatatgtgtgtggaaaagagacggtgttattcacacgtgtatgtctgttttaacgggac |
316 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485513 |
tctgctgggaatttggtttttagtggttcagctgataaaactatatgtgtgtggaaaagagacggtgttattcacacgtgtatgtctgttttaacgggac |
6485414 |
T |
 |
| Q |
317 |
atgatggtcccgtt |
330 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6485413 |
atgatggtcccgtt |
6485400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 110 - 149
Target Start/End: Complemental strand, 25702734 - 25702695
Alignment:
| Q |
110 |
tttattgtggtgcttctgatggattggttaacttttggga |
149 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
25702734 |
tttattgcggttcttctgatggattggttaacttttggga |
25702695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University