View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6920_low_9 (Length: 250)
Name: NF6920_low_9
Description: NF6920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6920_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 46333302 - 46333528
Alignment:
| Q |
16 |
acatcaattccaccgggactacgcgggcggatggagaaacggtaattggctgacaccttgcttgttatattgaaatgtttgatgttctgtccgcacttgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46333302 |
acatcaattccaccgggactacgcgggcggatggagaaacggtaattggctgacaccttgcttgttatattgaaatgtttgatgttctgtccacacttgg |
46333401 |
T |
|
| Q |
116 |
acacgtgctttgtatggttcaactcatgcatttattgtttttgactttaggtggcgatggaatcagaaggttttgccatttatgatgcaatgatgcagat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46333402 |
acacgtgctttgtatggttcaactcatgcatttattgtttttgactttaggtggcgatggagtcagaaggttttgccatttatgatgcaatgatgcagat |
46333501 |
T |
|
| Q |
216 |
gaaaacaactcaggtttgtttcttctcact |
245 |
Q |
| |
|
||| |||| ||||||||||||||||||| |
|
|
| T |
46333502 |
gaa---aactgaggtttgtttcttctcact |
46333528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University