View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6921_low_12 (Length: 275)
Name: NF6921_low_12
Description: NF6921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6921_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 51 - 258
Target Start/End: Original strand, 51223984 - 51224192
Alignment:
| Q |
51 |
gttaattcctaaaatatctccacaattatctatgtgttgagatgtgatttgatgcatgctttttacaaatacagtgcatagcagttattctcatattttc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51223984 |
gttaattcctaaaatatctccacaattatctatgtgttgagatgggatttgatgcatactttttacaaatacagtgcatatcagttattctcatattttc |
51224083 |
T |
|
| Q |
151 |
atgagaaaacattttggaaactaaaaagaga-nnnnnnnacctgagaattccaactgttgatgcattttgtaatctgagtacatataggcaaggccaact |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51224084 |
atgagaaaacattttggaaactaaaaagagattttttttacctgagaattccaactgttgatgcattttgtaatctgagtacatataggcaaggccaact |
51224183 |
T |
|
| Q |
250 |
ttcgatatt |
258 |
Q |
| |
|
||||||||| |
|
|
| T |
51224184 |
ttcgatatt |
51224192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 55 - 108
Target Start/End: Complemental strand, 5484970 - 5484917
Alignment:
| Q |
55 |
attcctaaaatatctccacaattatctatgtgttgagatgtgatttgatgcatg |
108 |
Q |
| |
|
||||||||||||||||||||| |||||| | |||||||||||| |||||||| |
|
|
| T |
5484970 |
attcctaaaatatctccacaaatatctaaaaggtgagatgtgattggatgcatg |
5484917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University